View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13367_low_11 (Length: 205)
Name: NF13367_low_11
Description: NF13367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13367_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 4e-80; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 21 - 192
Target Start/End: Complemental strand, 35085382 - 35085211
Alignment:
| Q |
21 |
tttaaaatttagtgttttggtttcgatttgtaattagggatttatgatgtagatgggggtaattcagtgcgggtttataagtgtcgtctggtttggannn |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35085382 |
tttaaaatttagtgttttggtttcgatttgtaattagggatttatgatgtagatgggggtaattcagtgcgggtttataagtgtcgtctggtttggattt |
35085283 |
T |
 |
| Q |
121 |
nnnngagtttgaatcggaagtggttctgggtataaactctggtaccagtagccctcggccgcccatatgatg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35085282 |
ttttgagtttgaatcggaagtggttctgggtataaactctggtaccagtagccctcggccgcccatatgatg |
35085211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 21 - 203
Target Start/End: Complemental strand, 35100689 - 35100507
Alignment:
| Q |
21 |
tttaaaatttagtgttttggtttcgatttgtaattagggatttatgatgtagatgggggtaattcagtgcgggtttataagtgtcgtctggtttggannn |
120 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35100689 |
tttaaaatttagggttttggtttcgatttgtaattagggatttatgatgtagatgggggtaattcaatgcgggtttataagtgtcgtctggtttggattt |
35100590 |
T |
 |
| Q |
121 |
nnnngagtttgaatcggaagtggttctgggtataaactctggtaccagtagccctcggccgcccatatgatgatgtccatctc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
35100589 |
ttttgagtttgaatcggaagtggttctgggtataaactctggtaccagtagccctcggccgcccatatgatggtgtccctctc |
35100507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 25 - 112
Target Start/End: Original strand, 43026898 - 43026983
Alignment:
| Q |
25 |
aaatttagtgttttggtttcgatttgtaattagggatttatgatgtagatgggggtaattcagtgcgggtttataagtgtcgtctggt |
112 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| |||||||| |||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43026898 |
aaatctagggttttggtttcgatttgtaattggggatttacaatgtgga--ggggtaattcagtgcgggtttataagtgtcgtctggt |
43026983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 25 - 104
Target Start/End: Original strand, 42795462 - 42795539
Alignment:
| Q |
25 |
aaatttagtgttttggtttcgatttgtaattagggatttatgatgtagatgggggtaattcagtgcgggtttataagtgt |
104 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||| ||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
42795462 |
aaatttagggttttggtttcgatttgtaattaggaatttacgatgtgga--ggggtaactcagtgcgggtttataagtgt |
42795539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University