View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13367_low_5 (Length: 398)
Name: NF13367_low_5
Description: NF13367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13367_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 26 - 214
Target Start/End: Complemental strand, 43016683 - 43016495
Alignment:
| Q |
26 |
ttttttagtagcgatgcaatcgcgatttgaataatgtctcaattgtttacataaagaaaattaaagagaaacaactacaagaagaatatttaagaagact |
125 |
Q |
| |
|
|||||| | |||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43016683 |
ttttttcgcagcgatgcaatcgcgacttgaattatgtctcaattgtttacataaagaaaattaaagagaaacaactacaagaagaatatttaagaagact |
43016584 |
T |
|
| Q |
126 |
aaattggaatggatgatgaataatacatacctgaaaattttcattttgttggagcatgattgttgaaacatggtaagaattgtcatcaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43016583 |
aaattggaatggatgatgaataatacatacctgaaaattttcattttgttggagcatgattgttgaaacatggtaagaattgtcatcaa |
43016495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 276 - 311
Target Start/End: Complemental strand, 43016433 - 43016398
Alignment:
| Q |
276 |
aggcctacttatatggaaagctgcgtttgcactaat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43016433 |
aggcctacttatatggaaagctgcgtttgcactaat |
43016398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University