View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13369_high_22 (Length: 209)
Name: NF13369_high_22
Description: NF13369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13369_high_22 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 24 - 209
Target Start/End: Complemental strand, 18656684 - 18656499
Alignment:
| Q |
24 |
gaatttccacttggagcaggagaaggaacaacagtactaggttgtttcaaaacaggtaattcagtaacaggaacaaaaacagtatcataatcatataaag |
123 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18656684 |
gaatttcctcttggagcaggagaaggaacaatagtactaggttgtttcaagacaggtaattcagtaacaggaacaaaaatagtatcataatcatataacc |
18656585 |
T |
 |
| Q |
124 |
tttcaccattaacatcaactatagacttttcacttgttccaaacatagaagcaatagaagaaacatcatcatgaggttgaacaaca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18656584 |
tttcaccattaacatcaactatagacttttcacttgttccaaacatagaagcaatagaagaaacattatcatgaggttgaacaaca |
18656499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University