View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13369_low_11 (Length: 388)
Name: NF13369_low_11
Description: NF13369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13369_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 133 - 380
Target Start/End: Complemental strand, 35130461 - 35130215
Alignment:
| Q |
133 |
ctgtgtcaaccctttttaaaccttgatagattctttatctctcatgagccaaaagaaaaaccttaccataaagtagttagtttagcattaacaacaagat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35130461 |
ctgtgtcaaccctttttaaaccttgatagattctttatctctcat-agccaaaagaaaaaccttcccataaagtagttagtttagcattagcaacaagat |
35130363 |
T |
|
| Q |
233 |
aatttagaattgagtccaagttaccgttaatgcaagctaaagatcaaatcatatgtatcaacggggttggccaaaggacatctcatttcaaattttgaaa |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35130362 |
aatttagaattgagtccaagttaccgttaatgcaagctaaagatcaaatcatatgtatcaacggggttggccaaaggacatctcatttcaaattttgaaa |
35130263 |
T |
|
| Q |
333 |
tattttaagtttaatggcacttatcttgccatgtttctcccctatgct |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35130262 |
tattttaagtttaatggcacttatcttgccatgtttctcccctatgct |
35130215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 35130547 - 35130463
Alignment:
| Q |
20 |
aatcaatgtagatccaattgataagaattcaacttagatatatgattttgcaatgaaatttgttgttgatgtgaagttttcatta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35130547 |
aatcaatgtagatccaattgataagaattcaaattagatataagattttgcaatgaaatttcttgttgatgtgaagttttcatta |
35130463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University