View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13369_low_16 (Length: 280)
Name: NF13369_low_16
Description: NF13369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13369_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 24 - 149
Target Start/End: Complemental strand, 51267570 - 51267445
Alignment:
| Q |
24 |
ttgtggaggagccgggctgatttcgtggtggttttagtgatgttggctggagggttaatggtggtcgatccggatccgatttatccgtcgttttcggtcc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51267570 |
ttgtggaggagccgggctgatttcgtggtggttttagtgatgttggctggagggttaatggtggtcgatccggatccgatttatccgtcgttttcggtcc |
51267471 |
T |
|
| Q |
124 |
ggttacgtctgatctgataaggatta |
149 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
51267470 |
ggttacatctgatctgataaggatta |
51267445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 24 - 149
Target Start/End: Complemental strand, 26681239 - 26681114
Alignment:
| Q |
24 |
ttgtggaggagccgggctgatttcgtggtggttttagtgatgttggctggagggttaatggtggtcgatccggatccgatttatccgtcgttttcggtcc |
123 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
26681239 |
ttgtggaggagccgggctgatttcgtgatggttttagtgatgttgactggagggataatggtggtcgatccggatctgatttatccgccgttttcggtcc |
26681140 |
T |
|
| Q |
124 |
ggttacgtctgatctgataaggatta |
149 |
Q |
| |
|
|||| |||| ||| |||||||||||| |
|
|
| T |
26681139 |
ggtttcgtccgatttgataaggatta |
26681114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University