View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13369_low_23 (Length: 232)
Name: NF13369_low_23
Description: NF13369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13369_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 3 - 214
Target Start/End: Complemental strand, 19473060 - 19472847
Alignment:
| Q |
3 |
tcaataggaattcaatacaactttaatnnnnnnnn--ttgaagaatttatattgaataatttttagagattatcatatttggcctataatttgactaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19473060 |
tcaataggaattcaatacaactttaataaaaaaaaaattgaagaatttatattgaataatttttagagattatcatatttggcctataattttactaagc |
19472961 |
T |
|
| Q |
101 |
atttaacctatatatannnnnnnaagtactttttcggtgatttgttgggactcagcagcaagttgcttcgaaagataatgtaaaattatcattgtacgat |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19472960 |
atttaacctatatatatttttttaagtactttttcggtgatttgttgggactcagcagcaagttgctgagaaagataatgtaaaattatcattgtacgat |
19472861 |
T |
|
| Q |
201 |
ctgtctgatataga |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19472860 |
ctgtctgatataga |
19472847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University