View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1336_low_12 (Length: 351)
Name: NF1336_low_12
Description: NF1336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1336_low_12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 314 - 351
Target Start/End: Original strand, 26164964 - 26165001
Alignment:
| Q |
314 |
ttttttgtacataatcaggaaatagttttggcccttta |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26164964 |
ttttttgtacataatcaggaaatagttttggcccttta |
26165001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University