View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1336_low_19 (Length: 292)
Name: NF1336_low_19
Description: NF1336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1336_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 54 - 224
Target Start/End: Original strand, 48016333 - 48016503
Alignment:
| Q |
54 |
aaaggaagcacgtgtgtctttgcctcgaaaacttaggaacacttcattaatccttaattctttcgaggcattcttcattgatgtgtgatcattccaaaat |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48016333 |
aaaggaagcacgtgtgtctttgcctcgaaaacttaggaacacttcattaatccttaattctttcgaggcattcttcattgatgtgtgatcattccaaaat |
48016432 |
T |
 |
| Q |
154 |
gattgtgcagattgggggaagttaatgaaggaagacatggatggatgagataagagaagcaatgttacttg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48016433 |
gattgtgcagattgggggaagttaatgaaggaagacatggatggatgagataagagaagcaatgttgcttg |
48016503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University