View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1336_low_23 (Length: 243)
Name: NF1336_low_23
Description: NF1336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1336_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 40496104 - 40496323
Alignment:
| Q |
1 |
actgctagaatgtattcaattttaagaaaataatatcgttcatgtaaaattttcagttcaatttcannnnnnnatnnnnnnnnntataaaattggttgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| || |||||||||||||||| |
|
|
| T |
40496104 |
actgctagaatgtattcaattttaagaaaataatatcgttcatgtaaaatattcggttcaatttcatttttttataaaaaaaa-tataaaattggttgga |
40496202 |
T |
 |
| Q |
101 |
agtttctaatatgatgcatgtggtgtgaaatgaatattatgaatacatcaataaagttagtcatgattttatttgatatgattggatcatagtgcgaacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40496203 |
agtttctaatatgatgcatgtggtgtgaaatgaatattatgaatacatcaataaagttagtcatgattttatttgatatgattggatcatagtgcgaacg |
40496302 |
T |
 |
| Q |
201 |
gagatggtaaaatgcaaacgt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40496303 |
gagatggtaaaatgcaaacgt |
40496323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 92 - 134
Target Start/End: Original strand, 40470036 - 40470078
Alignment:
| Q |
92 |
ttggttggaagtttctaatatgatgcatgtggtgtgaaatgaa |
134 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
40470036 |
ttggttggaagtttctaatgtaatgcatgtggtgtgaaatgaa |
40470078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University