View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13371_high_4 (Length: 317)
Name: NF13371_high_4
Description: NF13371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13371_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 14 - 313
Target Start/End: Complemental strand, 43702968 - 43702669
Alignment:
| Q |
14 |
cagcatttgcttcgccatccctcgccggtgcatcaatttgaacaccaacagcttcatcgctcacatctacttattacaataaccaataatcagttacacc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43702968 |
cagcatttgcttcgccatccctcgccggtgcatcaatttgaacaccaacagcttcatcgctcacatctacttattacaataaccaataatcagttacacc |
43702869 |
T |
|
| Q |
114 |
gaaatttcaatttcataaactaatatcgaagaaacgcaacattcnnnnnnnnnnnnnnnnncctgttatggatgcggactttgaaccgggtttagcgtgg |
213 |
Q |
| |
|
| |||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43702868 |
gtaatttcaatttcataaactaatattgaagaaacgcaacattcagagagagaaagagagacctgttatggatgcggactttgaaccgggtttagcgtgg |
43702769 |
T |
|
| Q |
214 |
atggttatagcgacggatgaaggaggcatgcagcgaatacaagacggaatattgttaggtttttccgaaggaaccgtttcctttggttctgcctttgctt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43702768 |
atggttatagcgacggatgaaggaggcatgcagcgaatacaagacggaatattgttaggtttttccgaaggaaccgtttcctttggttctgcctttgctt |
43702669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University