View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13371_high_5 (Length: 202)
Name: NF13371_high_5
Description: NF13371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13371_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 45082057 - 45081892
Alignment:
| Q |
18 |
ttttgagggag-tttaatggtattgttgttaggacatcaaatgctattttcttccata-ggatatagtatatataaggaatttaagttttgaaaagtaat |
115 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
45082057 |
ttttgagggagctttaatgctattgttgttaggacatcaaatgctattttcttccataaggatatagtatat----ggaatctaagttttgaaaagtaat |
45081962 |
T |
 |
| Q |
116 |
gaataataccactattttactgatccattttatatgaactccattaattcatttcaggatttgcaagcat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
45081961 |
gaataataccactattttactgatccattttatatgcacgccattggttcatttcaggatttgcaagcat |
45081892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University