View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13372_high_6 (Length: 237)
Name: NF13372_high_6
Description: NF13372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13372_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 28789177 - 28789397
Alignment:
| Q |
1 |
aaaatttgaggacggacaagcatataaatttaatcaaacaaaaactccaaaaaccatcaatagacaatttaaacccaaagttttagttcactgatatccc |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28789177 |
aaaatttgaggacggagaagcatataaatttaatcaaacaaaaactccaaaaagcatcaatagacaatttaaacccaaagttttagttcactgatatccc |
28789276 |
T |
 |
| Q |
101 |
taaatttgataacggtaacaaatagaaatgaattaattaaatagttcaagtaaaacaagcaaaaatttgcattgaaatatagaaggagggcattgatgag |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28789277 |
taaatttgataacagtaacaaatagaaatgaattaattaaatagttcaagtaaaacaagcaaaaatttgcattgaaatgtagaaggagggcattgatgag |
28789376 |
T |
 |
| Q |
201 |
agtcttcacttgagaggaata |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28789377 |
agtcttcacttgagaggaata |
28789397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 36 - 221
Target Start/End: Complemental strand, 31248198 - 31248016
Alignment:
| Q |
36 |
aaacaaaaactccaaaaacc--atcaatagacaatttaaacccaaagttttagttcactgatatccctaaatttgataacggtaacaaatagaaatgaat |
133 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||||||| |||||||||||||||||| | | | ||||| || |||||||||||| | |
|
|
| T |
31248198 |
aaacaaaaactccaaaaagctcataaatagacaatttaaacccaaaactttagttcactgatatcc--tattgtcataacaatatcaaatagaaatggag |
31248101 |
T |
 |
| Q |
134 |
taattaaatagttcaagtaaaacaagcaaaaatttgcattgaaatatagaaggagggcattgatgagagtcttcacttgagaggaata |
221 |
Q |
| |
|
| ||||||||||| |||||||||||||||| |||||||| ||| ||||| |||||| ||||| ||||||||||||||||||| |
|
|
| T |
31248100 |
catttaaatagttccagtaaaacaagcaaaagtttgcattaaaagataga---ggggcatcgatgacgatcttcacttgagaggaata |
31248016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University