View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13373_high_1 (Length: 398)
Name: NF13373_high_1
Description: NF13373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13373_high_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 1 - 375
Target Start/End: Complemental strand, 4932086 - 4931710
Alignment:
| Q |
1 |
aaggacatctcatatcgcatgcgtggtcaagtaagcattcaccgtaatcaatccattagggatatcccactttaggatatctcttaaggaaatcagacga |
100 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
4932086 |
aaggacatctcatatcgcatgcgggttcaagtaagcattcaccgtaatcaatccattaaggatatctcactttaggatatctcttaagggaatcagacga |
4931987 |
T |
 |
| Q |
101 |
ttcatacgactttgattgaaggacg--agtgattatggttcatgagagctatatggtcttatatccaatgatactgatagattgactcaagagatcgggg |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||| |||||| |||||| ||||||| |
|
|
| T |
4931986 |
ttcatacgactttgattgaaggactcaagtgattatggttcatgagaactatatggtcttatatccaacgatactgatcgattgaatcaagaaatcgggg |
4931887 |
T |
 |
| Q |
199 |
cggtatttgtgattggaaattcatttgcctcgattacatgggaatcattttgatattttgaagagtaattcttgcatgagatcgtagttttcgatcataa |
298 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4931886 |
cggtatttgtgagtggaaattcatttccctcgattacatgggaatcattttgatattttgaagagtaattcttgcatgagatcgtagttttcgatcataa |
4931787 |
T |
 |
| Q |
299 |
ctactcaaaaattcatgatatattaaaatgattaaaaggtgtccgtgtgcacaactgtggaggcttcggcatgggcg |
375 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4931786 |
ctactcaaaaattcatgatacattaaaatgattaaaaggtgtccgtgtgcacaactgtggaggcttcggcatgggcg |
4931710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University