View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13373_high_12 (Length: 232)
Name: NF13373_high_12
Description: NF13373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13373_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 10334799 - 10334598
Alignment:
| Q |
19 |
gctattttgggatttcttcaaaggccatgaagaagagtcaaaagcaaaacnnnnnnnn--caccaataagcaagaaatatgaaacaatgacaaaggttat |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10334799 |
gctattttgggatttcttcaaag-ccatgaagaagagtcaaaaacaaaacaaaaaaaaaacaccaataagcaagaaatatgaaacaataacaaaggttat |
10334701 |
T |
|
| Q |
117 |
taatgttaaaccttttagatgaagtgcctattttgggatgtgcggggcttggtcaatgccccgtcaagattggctctcaagagacttgtagatgagtata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10334700 |
taatgttaaaccttttagatgaagtgcctattttgggatgtgcggggcttggtcaatgccccgtcaagattggctctcaagagacttgtagatgagtata |
10334601 |
T |
|
| Q |
217 |
atc |
219 |
Q |
| |
|
||| |
|
|
| T |
10334600 |
atc |
10334598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University