View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13373_high_13 (Length: 203)
Name: NF13373_high_13
Description: NF13373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13373_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 33042567 - 33042748
Alignment:
| Q |
15 |
agcagagataagagattcgacgaggaatggaatgagggtgtggctaggaacctttgatagtgcagaagctgctgctttggcttatgatcaagcagctttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33042567 |
agcagagataagagattcgacgaggaatggaatgagggtgtggctaggaacctttgatagtgcagaagctgctgctttggcttatgatcaagcagctttt |
33042666 |
T |
 |
| Q |
115 |
tccatgagaggttcttctgcaatactcaattttcctgttgagattgttagagaatcgcttagtgatatgaattgtgatgatg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33042667 |
tccatgagaggttcttctgcaatactcaattttcctgttgagattgttagagaatcgcttagtgatatgaattgtgatgatg |
33042748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 49 - 126
Target Start/End: Complemental strand, 30710560 - 30710483
Alignment:
| Q |
49 |
agggtgtggctaggaacctttgatagtgcagaagctgctgctttggcttatgatcaagcagctttttccatgagaggt |
126 |
Q |
| |
|
||||| ||||||||||| ||||||||||| |||| ||||||||| |||||||||||||| || ||||| ||||||||| |
|
|
| T |
30710560 |
agggtttggctaggaacatttgatagtgctgaagatgctgctttagcttatgatcaagctgcattttcaatgagaggt |
30710483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 15 - 147
Target Start/End: Complemental strand, 16252177 - 16252045
Alignment:
| Q |
15 |
agcagagataagagattcgacgaggaatggaatgagggtgtggctaggaacctttgatagtgcagaagctgctgctttggcttatgatcaagcagctttt |
114 |
Q |
| |
|
|||||| ||||| ||||| || || |||| || ||||| ||| ||||||| ||||||||||| ||||| || || | |||||||||||||| |||||| |
|
|
| T |
16252177 |
agcagaaataagggattcaactagacatggcataagggtatggttaggaacatttgatagtgctgaagcagcagcactagcttatgatcaagctgctttt |
16252078 |
T |
 |
| Q |
115 |
tccatgagaggttcttctgcaatactcaatttt |
147 |
Q |
| |
|
|| ||||||||||| ||||||| ||| |||||| |
|
|
| T |
16252077 |
tcaatgagaggttcatctgcaacacttaatttt |
16252045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 49 - 127
Target Start/End: Complemental strand, 30689791 - 30689713
Alignment:
| Q |
49 |
agggtgtggctaggaacctttgatagtgcagaagctgctgctttggcttatgatcaagcagctttttccatgagaggtt |
127 |
Q |
| |
|
||||| ||||| ||||| ||||||||||| |||| ||||||||| |||||||||||||| || ||||| |||||||||| |
|
|
| T |
30689791 |
agggtttggcttggaacatttgatagtgctgaagatgctgctttagcttatgatcaagctgcattttcaatgagaggtt |
30689713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 49 - 127
Target Start/End: Complemental strand, 30718834 - 30718756
Alignment:
| Q |
49 |
agggtgtggctaggaacctttgatagtgcagaagctgctgctttggcttatgatcaagcagctttttccatgagaggtt |
127 |
Q |
| |
|
||||| ||||| ||||| ||||||||||| |||| ||||||||| |||||||||||||| || ||||| |||||||||| |
|
|
| T |
30718834 |
agggtttggcttggaacatttgatagtgctgaagatgctgctttagcttatgatcaagctgcattttcaatgagaggtt |
30718756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 49 - 126
Target Start/End: Complemental strand, 30656735 - 30656658
Alignment:
| Q |
49 |
agggtgtggctaggaacctttgatagtgcagaagctgctgctttggcttatgatcaagcagctttttccatgagaggt |
126 |
Q |
| |
|
||||| ||| ||||||| ||||||||||| |||| ||||||||| |||||||||||||| || ||||| ||||||||| |
|
|
| T |
30656735 |
agggtttggttaggaacatttgatagtgctgaagatgctgctttagcttatgatcaagctgcattttcaatgagaggt |
30656658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 55 - 126
Target Start/End: Complemental strand, 30698671 - 30698600
Alignment:
| Q |
55 |
tggctaggaacctttgatagtgcagaagctgctgctttggcttatgatcaagcagctttttccatgagaggt |
126 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||| |||||||||||||| || || || ||||||||| |
|
|
| T |
30698671 |
tggctaggaacatttgatagtgctgaagatgctgctttagcttatgatcaagctgcattctcaatgagaggt |
30698600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 49 - 126
Target Start/End: Complemental strand, 30671896 - 30671819
Alignment:
| Q |
49 |
agggtgtggctaggaacctttgatagtgcagaagctgctgctttggcttatgatcaagcagctttttccatgagaggt |
126 |
Q |
| |
|
||||| ||||| ||||| ||||| ||||| |||| ||||||||| |||||||||||||| || ||||| ||||||||| |
|
|
| T |
30671896 |
agggtttggcttggaacatttgacagtgctgaagatgctgctttagcttatgatcaagctgcattttcaatgagaggt |
30671819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 113
Target Start/End: Complemental strand, 30623922 - 30623888
Alignment:
| Q |
79 |
gaagctgctgctttggcttatgatcaagcagcttt |
113 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
30623922 |
gaagctgctgctttagcttatgatcaagcagcttt |
30623888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 79 - 116
Target Start/End: Original strand, 38862497 - 38862534
Alignment:
| Q |
79 |
gaagctgctgctttggcttatgatcaagcagctttttc |
116 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38862497 |
gaagcagctgctttagcttatgatcaagcagctttttc |
38862534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University