View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13373_low_13 (Length: 232)

Name: NF13373_low_13
Description: NF13373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13373_low_13
NF13373_low_13
[»] chr1 (1 HSPs)
chr1 (19-219)||(10334598-10334799)


Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 10334799 - 10334598
Alignment:
19 gctattttgggatttcttcaaaggccatgaagaagagtcaaaagcaaaacnnnnnnnn--caccaataagcaagaaatatgaaacaatgacaaaggttat 116  Q
    ||||||||||||||||||||||| ||||||||||||||||||| ||||||          |||||||||||||||||||||||||||| |||||||||||    
10334799 gctattttgggatttcttcaaag-ccatgaagaagagtcaaaaacaaaacaaaaaaaaaacaccaataagcaagaaatatgaaacaataacaaaggttat 10334701  T
117 taatgttaaaccttttagatgaagtgcctattttgggatgtgcggggcttggtcaatgccccgtcaagattggctctcaagagacttgtagatgagtata 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10334700 taatgttaaaccttttagatgaagtgcctattttgggatgtgcggggcttggtcaatgccccgtcaagattggctctcaagagacttgtagatgagtata 10334601  T
217 atc 219  Q
    |||    
10334600 atc 10334598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University