View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13374_high_19 (Length: 234)
Name: NF13374_high_19
Description: NF13374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13374_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 40 - 153
Target Start/End: Original strand, 52875959 - 52876071
Alignment:
| Q |
40 |
ttttttattctttcgagaatatttgtttgcctctgactctatttctccnnnnnnnnnngttggatagatttttctttactat-aaaaatgtatcatatga |
138 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52875959 |
tttttttttctttcgagaatatttgtttgcctctgactctatttctcctttttttt--gttggatagatttttctttactataaaaaatgtatcatatga |
52876056 |
T |
 |
| Q |
139 |
aactagtcaattcaa |
153 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
52876057 |
aattagtcaattcaa |
52876071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 9624552 - 9624596
Alignment:
| Q |
1 |
ttctatcttatgatcttctctggtattctatgcttttcatttttt |
45 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
9624552 |
ttctatcttatgatcttctcttgcgttctatgcttttcatttttt |
9624596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University