View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13374_low_14 (Length: 341)
Name: NF13374_low_14
Description: NF13374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13374_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 13 - 321
Target Start/End: Complemental strand, 32162880 - 32162572
Alignment:
| Q |
13 |
aatatcacgtaattgagacgctgttttaagcagaatggagaaaacgacgaggtcgttgaaggaaccgagagtggttcgcgcaaggttgtagaatgaaacg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32162880 |
aatatcacgtaattgagacgctgttttaagcagaatggagaaaacgacgaggtcgttgaaggaaccgagagtggttcgcgcaaggttgtagaatgaaacg |
32162781 |
T |
|
| Q |
113 |
acgtgggagtggatgtcgttaaggaaatgccaacgaatgatgagtttgaaggagtggtgggttggtgagggaagacggtggaagagagtgcgagcgtggc |
212 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32162780 |
acgtgggagtggacgtcgttgaggaaatgccaacgaatgatgagtttgaaggagtggtgggttggtgagggaagacggtggaagagagtgcgagcgtggc |
32162681 |
T |
|
| Q |
213 |
ggaggaagccgaaggaggcgtagagagagatgagggtggtgtcgggaggatggccggagatgatgagggaagcgtggagggttttgacggtggtgggatg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32162680 |
ggaggaagccgaaggaggcgtagagagagatgagggtggtgtcgggaggatggccggagatgatgagggaagcgtggagggttttgacggtggtgggatg |
32162581 |
T |
|
| Q |
313 |
tttgcagat |
321 |
Q |
| |
|
||||||||| |
|
|
| T |
32162580 |
tttgcagat |
32162572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University