View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13374_low_15 (Length: 326)
Name: NF13374_low_15
Description: NF13374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13374_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 166 - 312
Target Start/End: Original strand, 18013416 - 18013564
Alignment:
| Q |
166 |
ctatatcatcaacatacataagaatctctgtatcatatgcattaacatatctgttaaatttgtgttagcaacttagatatctaaatatctatgatcatag |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18013416 |
ctatatcatcaacatacataagaatctctgtatcatatgcattaacatatctgttcaatttttgttagcaagttagatatctaaatatctatgatcatag |
18013515 |
T |
 |
| Q |
266 |
aataataaca--ttacctttacggagctttaacgaaaaccgaaaaattg |
312 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18013516 |
aataataaaattttacctttacggagctttaacgaaaaccgaaaaattg |
18013564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 10 - 108
Target Start/End: Original strand, 18013260 - 18013358
Alignment:
| Q |
10 |
tcatcaacaatattcaaacattttctcattgtaaatctacagagaaaaataataaattctcagaacatttgagatcaaagaattgcttagtcgattagg |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18013260 |
tcatccacaatattcaaacattttctcattgtaaatgtgcagagaaaaataataaattctcagaacatttgagatcaaagaattgcttagtcgattagg |
18013358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University