View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13374_low_17 (Length: 306)
Name: NF13374_low_17
Description: NF13374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13374_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 8 - 288
Target Start/End: Original strand, 41125976 - 41126256
Alignment:
| Q |
8 |
cgaagaaaatagagagtaatcaaagcatttttcacagttttctgaaagcttttcctcggcttttgaagcttgatccatcttttatccttcgacaacaacg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41125976 |
cgaagaaaatagagagtaatcaaagcatttttcacagttttctgaaagcttttcctcggcttttgaagcttgatccatcttttatccttcgacaacaacg |
41126075 |
T |
 |
| Q |
108 |
atacctcaggtttcaaaccagttagatcaaacttccatgcagtaacctccatgaaaatcgtctgcaacccattgtcagcagatccatgcaaaaatatctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41126076 |
atacctcaggtttcaaaccagttagatcaaacttccatgcagtaacctccatgaaaattgtctgcaacccattgtcagcagatccatgcaaaaatatctt |
41126175 |
T |
 |
| Q |
208 |
caaccccttttcggtatcatcaactttggaaaccttagaagcgccccatttaaacggtagaacagagaaacacacgggttc |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41126176 |
caaccccttttcggtatcatcaactttggaaaccttagaagcgccccatttaaacggtagaacagagaaacacacgggttc |
41126256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University