View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13374_low_19 (Length: 247)
Name: NF13374_low_19
Description: NF13374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13374_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 39996604 - 39996375
Alignment:
| Q |
1 |
ttccactggttatcgttcaactcacaaattttaactgcggtgtagttagtattagtttgttaatctcacacacagttgctgatggaccaagcgcgttaca |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
39996604 |
ttccactggttatctttcaactcacaaattttaattgcggtgtagttagtattagtttgttaatctcacacgcagttgctgatggaccaagcgcgttgca |
39996505 |
T |
 |
| Q |
101 |
tttcatttttgagtgggctcggattgcacgtggtgagcctttgaaaatggtgccaaggtttctcgatacaaacatgttgtcgccaaaatgttgcaacagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
39996504 |
tttcatttttgagtgggctcggattgcacgtggtgagcctttgaaaatggtgccaaggtttctcgatacaaacatgttgtcgccaaaacgttgtaacagt |
39996405 |
T |
 |
| Q |
201 |
gttaataaatgggagcctgatcaacttcct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39996404 |
gttaataaatgggagcctgatcaacttcct |
39996375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 53036991 - 53037130
Alignment:
| Q |
1 |
ttccactggttatcgttcaactcacaaattttaactgcggtgtagttagtattagtttgttaatctcacacacagttgctgatggaccaagcgcgttaca |
100 |
Q |
| |
|
||||| ||||||| ||||| ||||||||||| || || |||| | ||| ||||||||||||||||||||| | |||||||||||||||||||| || || |
|
|
| T |
53036991 |
ttccattggttattgttcagctcacaaatttcaaatgtggtggtgctagcattagtttgttaatctcacacgcggttgctgatggaccaagcgcattgca |
53037090 |
T |
 |
| Q |
101 |
tttcatttttgagtgggctcggattgcacgtggtgagcct |
140 |
Q |
| |
|
||||| || ||||||||| || |||| ||||| |||||| |
|
|
| T |
53037091 |
tttcacttctgagtgggcacgacttgcgcgtggcgagcct |
53037130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University