View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13374_low_20 (Length: 238)
Name: NF13374_low_20
Description: NF13374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13374_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 9 - 215
Target Start/End: Original strand, 23495688 - 23495894
Alignment:
| Q |
9 |
tattcttaagtgagttcttagatttaagaatcgattattcctgagttatacaattggattatgttaacatggattctagccgtgagaacgatacgagagt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23495688 |
tattcttaagtgagttcttagatttaagaatcgattattcctgagttatacaattggagcatgttaacatggattctagccgtgagaacgatacgagagt |
23495787 |
T |
 |
| Q |
109 |
tttgttctttgcannnnnnnctcactcatcagagccaataatattacatttgatgtagatgtagacatgtaataacctcccttttcaccaatgaagatgc |
208 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23495788 |
tttgttctttgcatttttttttcactcatcagagccaataatattacatttgatgtagatgtagacatgtaataacctcccttttcaccaatgaagatgc |
23495887 |
T |
 |
| Q |
209 |
tcaagca |
215 |
Q |
| |
|
| ||||| |
|
|
| T |
23495888 |
ttaagca |
23495894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University