View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13374_low_21 (Length: 234)

Name: NF13374_low_21
Description: NF13374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13374_low_21
NF13374_low_21
[»] chr1 (1 HSPs)
chr1 (40-153)||(52875959-52876071)
[»] chr8 (1 HSPs)
chr8 (1-45)||(9624552-9624596)


Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 40 - 153
Target Start/End: Original strand, 52875959 - 52876071
Alignment:
40 ttttttattctttcgagaatatttgtttgcctctgactctatttctccnnnnnnnnnngttggatagatttttctttactat-aaaaatgtatcatatga 138  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||| |||||||||||||||||    
52875959 tttttttttctttcgagaatatttgtttgcctctgactctatttctcctttttttt--gttggatagatttttctttactataaaaaatgtatcatatga 52876056  T
139 aactagtcaattcaa 153  Q
    || ||||||||||||    
52876057 aattagtcaattcaa 52876071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 9624552 - 9624596
Alignment:
1 ttctatcttatgatcttctctggtattctatgcttttcatttttt 45  Q
    ||||||||||||||||||||| |  ||||||||||||||||||||    
9624552 ttctatcttatgatcttctcttgcgttctatgcttttcatttttt 9624596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University