View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13375_high_22 (Length: 318)
Name: NF13375_high_22
Description: NF13375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13375_high_22 |
 |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 10 - 300
Target Start/End: Complemental strand, 28543844 - 28543550
Alignment:
| Q |
10 |
ataatactccctccatttacaatgagtgtcacttacgcccaaaaaattgtttcaaaatgaatgtcgttttcagtttttaatgaacatgatatttgttttc |
109 |
Q |
| |
|
|||||||||||||||||| || |||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28543844 |
ataatactccctccattttcattgagtgccatttacgccaaaaaaattgtttcaaaatgaatgtcgttttcagtttttaatgaacatgatatttgttttc |
28543745 |
T |
 |
| Q |
110 |
ttccaattatacactctaactaagtatatctatatggtcccttaatatatgtgtataaaaccctaaacaaaataggtgggcaggttaaa---tgnnnnnn |
206 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28543744 |
ttccaattatacactctaattaagtctatctatatggtcccttaatatatgtgtataaaaccctaaacaaaataggtgggcaggttaaacacaaaaaaaa |
28543645 |
T |
 |
| Q |
207 |
nncaggggtgctgcttgcacaaattgtnnnnnnnactggtagcacc-agatgttggagtgctcgtagcaccaaaagcaggggtgcctgttaaacc |
300 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28543644 |
aacaggggtgctgcttgcacaaattgcggggagcactggtagcaccaagatgttggagtgctcgtagcaccaaaagcaggggtgcctgttaaacc |
28543550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 96
Target Start/End: Original strand, 34911319 - 34911363
Alignment:
| Q |
52 |
aaaattgtttcaaaatgaatgtcgttttcagtttttaatgaacat |
96 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
34911319 |
aaaattgtttcaaactgaatgacgttttcagtttttaacgaacat |
34911363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 50 - 85
Target Start/End: Complemental strand, 38531456 - 38531421
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagttt |
85 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38531456 |
aaaaaattgtttcaaaatgaatgtcattttcagttt |
38531421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 15573599 - 15573640
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
15573599 |
aaaaaattgtttcaaaatgaatgtcactttcagttttcaatg |
15573640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 38132361 - 38132304
Alignment:
| Q |
18 |
ccctccattt-acaatgagtgtcacttacgcccaaaaaattgtttcaaaatgaatgtc |
74 |
Q |
| |
|
|||||||||| | |||||||||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
38132361 |
ccctccatttcaaaatgagtgtcgctttagccaaaaaaattgtttcaaaatgaatgtc |
38132304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 86
Target Start/End: Original strand, 46045965 - 46046001
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttt |
86 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46045965 |
aaaaaattgtttcaaaatgaatgtcactttcagtttt |
46046001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 16565259 - 16565218
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
16565259 |
aaaaaattgtttcaaaatgaatgtcattttcagtttctaatg |
16565218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 16600403 - 16600444
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
16600403 |
aaaaaattgtttcaaaatgaatgtcattttcagtttctaatg |
16600444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 2297030 - 2297071
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
2297030 |
aaaaaattgtttcaaaatgaatgtcactttcagttttcaatg |
2297071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 19105160 - 19105119
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
19105160 |
aaaaaattgttttaaaatgaatgtcactttcagtttttaatg |
19105119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 24780465 - 24780424
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
24780465 |
aaaaaattgtttcaaaatgaatgtcactttcagtttctaatg |
24780424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 42880093 - 42880052
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
42880093 |
aaaaaattgtttcaaaatgaatgtcactttcagttttcaatg |
42880052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 85
Target Start/End: Complemental strand, 716047 - 715987
Alignment:
| Q |
25 |
tttacaatgagtgtcacttacgcccaaaaaattgtttcaaaatgaatgtcgttttcagttt |
85 |
Q |
| |
|
|||| |||||||||| ||| ||| ||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
716047 |
tttaaaatgagtgtcgctttagccaaaaaatttgtttcaaaatgaatgtcactttcagttt |
715987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 85
Target Start/End: Original strand, 1741946 - 1742018
Alignment:
| Q |
14 |
tactccctccattt-acaatgagtgtcacttacgcccaaaaaattgtttcaaaatgaatgtcgttttcagttt |
85 |
Q |
| |
|
|||||||||| ||| | |||||||||| || ||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
1741946 |
tactccctccgtttcaaaatgagtgtcgttttagcccaaaaagttgtttcaaaatgaatgtcactttcagttt |
1742018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 6518968 - 6519009
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
6518968 |
aaaaaattgtttcaaaatgaatgtcgctttcagttttcaatg |
6519009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 43584538 - 43584497
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
43584538 |
aaaaaattgttttaaaatgaatgtcgttttcagttttcaatg |
43584497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 50 - 86
Target Start/End: Complemental strand, 34446188 - 34446152
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttt |
86 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34446188 |
aaaaaattgtttcaaaatgaatgtcattttcagtttt |
34446152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 50 - 95
Target Start/End: Original strand, 38809605 - 38809650
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatgaaca |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
38809605 |
aaaaaattgtttcaaaatgaatgtcgttttcaactttcaatgaaca |
38809650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 48 - 91
Target Start/End: Complemental strand, 4658396 - 4658353
Alignment:
| Q |
48 |
ccaaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||| |||| |
|
|
| T |
4658396 |
ccaaaaaattgtttcaaaatgaatgtctttttcatttttcaatg |
4658353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 59 - 91
Target Start/End: Complemental strand, 9391710 - 9391678
Alignment:
| Q |
59 |
tttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
9391710 |
tttcaaaatgaatgtcattttcagtttttaatg |
9391678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 14285905 - 14285965
Alignment:
| Q |
25 |
tttacaatgagtgtcacttacgcccaaaaaattgtttcaaaatgaatgtcgttttcagttt |
85 |
Q |
| |
|
|||| ||||||| ||| || ||| |||||||| |||||||||||||||| |||||||||| |
|
|
| T |
14285905 |
tttaaaatgagtatcattttagccaaaaaaattatttcaaaatgaatgtcattttcagttt |
14285965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 74
Target Start/End: Original strand, 34225745 - 34225789
Alignment:
| Q |
30 |
aatgagtgtcacttacgcccaaaaaattgtttcaaaatgaatgtc |
74 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
34225745 |
aatgagtgtcgctttagccaaaaaaattgtttcaaaatgaatgtc |
34225789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 91
Target Start/End: Complemental strand, 37038930 - 37038886
Alignment:
| Q |
47 |
cccaaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||| |||| |
|
|
| T |
37038930 |
cccaaaaaattgttttaaaatgaatgtcactttcagttttcaatg |
37038886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 50 - 85
Target Start/End: Complemental strand, 52915707 - 52915672
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagttt |
85 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52915707 |
aaaaaattgtttcaaaatgaatgtcgctttcagttt |
52915672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 20448031 - 20448072
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
20448031 |
aaaaaattgtttcaaaatgaatgtcactttcagttttcaatg |
20448072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 79
Target Start/End: Complemental strand, 39671244 - 39671215
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgtttt |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39671244 |
aaaaaattgtttcaaaatgaatgtcgtttt |
39671215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 51733659 - 51733618
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
51733659 |
aaaaaattgtttcaaaatgaatgtcactttcagtttctaatg |
51733618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 74
Target Start/End: Complemental strand, 1868281 - 1868237
Alignment:
| Q |
30 |
aatgagtgtcacttacgcccaaaaaattgtttcaaaatgaatgtc |
74 |
Q |
| |
|
|||||||||||||| | | ||||||||||||||||||||||||| |
|
|
| T |
1868281 |
aatgagtgtcactttagtcaaaaaaattgtttcaaaatgaatgtc |
1868237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 86
Target Start/End: Complemental strand, 49080641 - 49080605
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttt |
86 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49080641 |
aaaaaattgtttcaaaatgaatgtcactttcagtttt |
49080605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 50 - 85
Target Start/End: Complemental strand, 30426482 - 30426447
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagttt |
85 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30426482 |
aaaaaattgtttcaaaatgaatgtcattttcagttt |
30426447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 50 - 85
Target Start/End: Original strand, 48901712 - 48901747
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagttt |
85 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48901712 |
aaaaaattgtttcaaaatgaatgtcattttcagttt |
48901747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 50 - 85
Target Start/End: Original strand, 48903278 - 48903313
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagttt |
85 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48903278 |
aaaaaattgtttcaaaatgaatgtcattttcagttt |
48903313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 91
Target Start/End: Complemental strand, 3152989 - 3152923
Alignment:
| Q |
25 |
tttacaatgagtgtcacttacgcccaaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
|||| ||||||||||| || || ||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
3152989 |
tttaaaatgagtgtcattttagcaaaaaaaattgtttcaaaatgaatgtcactttcagttttcaatg |
3152923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 79
Target Start/End: Original strand, 49470782 - 49470811
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgtttt |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49470782 |
aaaaaattgtttcaaaatgaatgtcgtttt |
49470811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 75
Target Start/End: Complemental strand, 20512696 - 20512632
Alignment:
| Q |
12 |
aatactccctccattt-acaatgagtgtcacttacgcccaaaaaattgtttcaaaatgaatgtcg |
75 |
Q |
| |
|
|||||||||||| ||| | |||||||||| || ||| |||||||||||||||||||||||||| |
|
|
| T |
20512696 |
aatactccctccgtttcaaaatgagtgtcgttttagccaaaaaaattgtttcaaaatgaatgtcg |
20512632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 1574 - 1533
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
1574 |
aaaaaattgtttcaaaatgaatgtcactttcagtttctaatg |
1533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 6374406 - 6374447
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
6374406 |
aaaaaattgtttcaaaatgaatgtcactttcagttttcaatg |
6374447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 85
Target Start/End: Complemental strand, 39698865 - 39698792
Alignment:
| Q |
13 |
atactccctccattt-acaatgagtgtcacttacgcccaaaaaattgtttcaaaatgaatgtcgttttcagttt |
85 |
Q |
| |
|
||||||||||| ||| | |||||||||| || ||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39698865 |
atactccctccgtttcaaaatgagtgtcgttttagccaaaaaaattgtttcaaaatgaatgtcactttcagttt |
39698792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 39766020 - 39765979
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
39766020 |
aaaaaattgtttcaaaatgaatgtcactttcagttttcaatg |
39765979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 91
Target Start/End: Original strand, 40228566 - 40228607
Alignment:
| Q |
50 |
aaaaaattgtttcaaaatgaatgtcgttttcagtttttaatg |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
40228566 |
aaaaaattgtttcaaaatgaatgtcactttcagttttcaatg |
40228607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 85
Target Start/End: Complemental strand, 24163913 - 24163840
Alignment:
| Q |
13 |
atactccctccattt-acaatgagtgtcacttacgcccaaaaaattgtttcaaaatgaatgtcgttttcagttt |
85 |
Q |
| |
|
||||||||||| ||| | ||||||||||| || ||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
24163913 |
atactccctccgttttaaaatgagtgtcattttagccaaaaaaattgttttaaaatgaatgtcactttcagttt |
24163840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 85
Target Start/End: Original strand, 29399937 - 29399973
Alignment:
| Q |
49 |
caaaaaattgtttcaaaatgaatgtcgttttcagttt |
85 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29399937 |
caaaaaattgtttcaaaatgaatgtcactttcagttt |
29399973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University