View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13375_high_31 (Length: 247)
Name: NF13375_high_31
Description: NF13375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13375_high_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 8468223 - 8467980
Alignment:
| Q |
1 |
atgtcatctgtgtgcttccccttttaagccaaagtgaccaaaacaaaaacacattggcattctaatccaccgcca-agtcacgtcaccgattttttcact |
99 |
Q |
| |
|
|||| ||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8468223 |
atgttatctgcgcgcttccccttttaagccaaagtgaccaaaacaaaaacacagtggcattctaatccaccgccagagtcacgtcaccgattttttcact |
8468124 |
T |
 |
| Q |
100 |
ttccacaagtaactcttatattgacaccacgtgtacgttcttgatatctctttgccacgttggcaacctccatcactggactctaccaatagcaaactaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8468123 |
ttccacaagtaactcttatattgacaccacgtgtacgttcttgatatctctttgccacgttggcaacctccatcactggactctaccaatagcaaactaa |
8468024 |
T |
 |
| Q |
200 |
ttattatctaactatttaacacaagttaccgtttcatctcactc |
243 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
8468023 |
ttattatcttactatttaacacaagttaccgtttcatctaactc |
8467980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University