View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13375_low_35 (Length: 244)
Name: NF13375_low_35
Description: NF13375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13375_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 116 - 227
Target Start/End: Complemental strand, 12061068 - 12060955
Alignment:
| Q |
116 |
caagtctgccagcaggaccagcggacacag--ttatttgaagaaaacaatcaacttttcttcattgattgttgtttgaagaattagcaaacacagttatt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12061068 |
caagtctgccagcaggaccagcggacacacacttatttgaagaaaacaatcaacttttcttcattgattgttgtttgaagaattagcaaacacagttatt |
12060969 |
T |
 |
| Q |
214 |
ttatgtatttcttt |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12060968 |
ttatgtatttcttt |
12060955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 47
Target Start/End: Complemental strand, 12061174 - 12061137
Alignment:
| Q |
10 |
caaaggaccaaaagcacaaccttaacaacaccactcga |
47 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
12061174 |
caaagggccaaaagcacacccttaacaacaccactcga |
12061137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University