View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13375_low_38 (Length: 218)
Name: NF13375_low_38
Description: NF13375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13375_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 13 - 200
Target Start/End: Complemental strand, 30649653 - 30649478
Alignment:
| Q |
13 |
aagaatatgtgagagacattcgtgaagacaaccacacaaatgacttgaagaatttgcgatgatatgtctaaaaaccctaaatttgtttgtgggtggagaa |
112 |
Q |
| |
|
|||| ||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30649653 |
aagagtatgtgaaagagattcgtgaagacagccacacaaatgacttgaagaatttgcgatgatatgtctaaaaaccctaaatttgtttg----------- |
30649565 |
T |
 |
| Q |
113 |
caatgagcagttaatcacaaaaagtacaggtcattctctaaaattatcaattttcacaaccaattccaagtaacattagcaagctaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30649564 |
-aatgagcagttaatcacaaaaagtacaagtccttctctaaaattatcaattttcacaaccaattccaagtaacattagcaagctaag |
30649478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University