View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13375_low_39 (Length: 218)
Name: NF13375_low_39
Description: NF13375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13375_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 37108499 - 37108693
Alignment:
| Q |
1 |
cttttggtgaaccaccctttgctgttccatacccttgaccgaagacactgactccaggtaccatgtttccaccggctgttgataaagtatgagatccatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37108499 |
cttttggtgaaccaccctttgctgttccatagccttgaccgaagacactgactccaggtaccatgtttccaccggctgttgataaagtatgagatccatg |
37108598 |
T |
 |
| Q |
101 |
accttcattgtcacgaggtgtttcaaaggaagaatttagtgggacagttagtctcgaagcatagcctttgttgaaataccttgctccaatcagtt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37108599 |
accttcattgtcacgaggtgtttcaaaggaagaatttagtgggacagttagtctcgaagcatagcctttgttgaaataccttgctccaatcagtt |
37108693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University