View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13376_low_3 (Length: 340)
Name: NF13376_low_3
Description: NF13376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13376_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 23 - 209
Target Start/End: Complemental strand, 47051507 - 47051321
Alignment:
| Q |
23 |
caggtcaaaacttccatacaaattactcaaccattcaaatgtcttaaacagctaaacctcgtccttttcgcggattcgtttatatatgacatgggctatg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051507 |
caggtcaaaacttccatacaaattactcaaccattcaaatgtcttaaacagctaaacctcgtccttttcgcggattcgtttatatatgacatgggctatg |
47051408 |
T |
|
| Q |
123 |
gtcttttgtggattttaaacatacttcaagcttctactcttttgcagaaactttcaatcatggtgagtgaacatgttaagacaaatg |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051407 |
gtcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggtgagtgaacatgttaagacaaatg |
47051321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 255 - 340
Target Start/End: Complemental strand, 47051275 - 47051190
Alignment:
| Q |
255 |
atcttggttcagtaaataaatttacacttttgacagtcacatacaattcaactggacatccttatattcaaaattaatttgtgtct |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47051275 |
atcttggttcagtaaataaatttacacttttgacagccacatacaattcaattggacatccttatattcaaaattaatttgtgtct |
47051190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 196
Target Start/End: Original strand, 47929058 - 47929131
Alignment:
| Q |
123 |
gtcttttgtggattttaaacatacttcaagcttctactcttttgcagaaactttcaatcatggtgagtgaacat |
196 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
47929058 |
gtcttttgtggattttaaacatccttcaagcttctcctcttctgcagaaactctctgtcatggtgagtgaacat |
47929131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 131 - 196
Target Start/End: Complemental strand, 48107571 - 48107506
Alignment:
| Q |
131 |
tggattttaaacatacttcaagcttctactcttttgcagaaactttcaatcatggtgagtgaacat |
196 |
Q |
| |
|
|||||||||||||| ||||||| || | || ||||||||||||||||| |||||||||||||||| |
|
|
| T |
48107571 |
tggattttaaacatccttcaagtttgtccttttttgcagaaactttcagccatggtgagtgaacat |
48107506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 124 - 197
Target Start/End: Complemental strand, 48453503 - 48453430
Alignment:
| Q |
124 |
tcttttgtggattttaaacatacttcaagcttctactcttttgcagaaactttcaatcatggtgagtgaacatg |
197 |
Q |
| |
|
|||||| |||||||||||||| || |||| |||| |||||||||||||||||| | |||||||| ||||||| |
|
|
| T |
48453503 |
tcttttctggattttaaacatcctacaagtttctcctcttttgcagaaacttttggttatggtgagcgaacatg |
48453430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 131 - 186
Target Start/End: Original strand, 48895116 - 48895171
Alignment:
| Q |
131 |
tggattttaaacatacttcaagcttctactcttttgcagaaactttcaatcatggt |
186 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||| ||||||||| ||||||| |
|
|
| T |
48895116 |
tggattttaaacattcttcaagcttgccctcttttgcataaactttcagtcatggt |
48895171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 193
Target Start/End: Complemental strand, 48571222 - 48571156
Alignment:
| Q |
127 |
tttgtggattttaaacatacttcaagcttctactcttttgcagaaactttcaatcatggtgagtgaa |
193 |
Q |
| |
|
||||||||| |||||||| ||| |||||||| || ||||||||||| | || |||||||||||||| |
|
|
| T |
48571222 |
tttgtggatcttaaacatccttaaagcttctcctattttgcagaaattgtccctcatggtgagtgaa |
48571156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 72
Target Start/End: Complemental strand, 48571304 - 48571255
Alignment:
| Q |
23 |
caggtcaaaacttccatacaaattactcaaccattcaaatgtcttaaaca |
72 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
48571304 |
caggtcacaacttctctacaaattactcaaccattcaaacatcttaaaca |
48571255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 124 - 197
Target Start/End: Original strand, 50459595 - 50459668
Alignment:
| Q |
124 |
tcttttgtggattttaaacatacttcaagcttctactcttttgcagaaactttcaatcatggtgagtgaacatg |
197 |
Q |
| |
|
||||||||||||| | ||||| |||||| ||| | ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50459595 |
tcttttgtggattctcaacatccttcaaacttttcctcaattgcagaaactttcaatcatggtgagtgaacatg |
50459668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University