View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13377_low_12 (Length: 339)
Name: NF13377_low_12
Description: NF13377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13377_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 323
Target Start/End: Complemental strand, 22101860 - 22101546
Alignment:
| Q |
9 |
gatatgaaaccccacacctacagctcattgcgcagcaacgaaacaataagcttccacatgccatttgtagccctgtagccaatcccacggaatgactcag |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||||| ||||||||||||||| |
|
|
| T |
22101860 |
gatacgaaaccccacacctacagctcattgcgcagcaacgaaacaataagcctccacatgccatttatagccctatagccaatcacacggaatgactcag |
22101761 |
T |
|
| Q |
109 |
aggaaacaagctccaaacacacgtagaacccagatcgagggatgatttcaacagtacaccctcgagtaacaacagtccaaacgaaacatactcttgcatg |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
22101760 |
aggaaacaagctccaaacacgcgtagaacccagatcgagggatgatttcaacagtacaccctcaagtcacaacagcccaaacgaaacggactcttgcatg |
22101661 |
T |
|
| Q |
209 |
tgttttgagaccgaaccggagccattccaaaaactcgagtgtggcagacgcaaatctaaaactttgaaacctgcggttctcaacagatatagaccaatgc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
22101660 |
tgttttgagaccgaaccggagccattccaaaaactcgaatgtggatgacacaaatctaaaacttcgaaacctgcggttctcaacagatatagaccaatcc |
22101561 |
T |
|
| Q |
309 |
aggaaaccaaaggac |
323 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
22101560 |
aggaaaccaaaggac |
22101546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University