View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13377_low_14 (Length: 298)
Name: NF13377_low_14
Description: NF13377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13377_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 28740953 - 28740663
Alignment:
| Q |
1 |
ctgctaaaggaatggttcttaccccctctcccaagaaaccattaggcctccgacagccatcacccaagattggcttctttgacagggtgagtgttgtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28740953 |
ctgctaaaggaatggttcttaccccctctcccaagaaaccattaggcctccgacagccatcacccaagattggcttctttgacagggtgagtgttgtttt |
28740854 |
T |
 |
| Q |
101 |
atttgtgttaaatagacttaggaactgattttgtctgtataatgttcatggacatgttatcaatctttgtatggctaaattttaattaagccacctagct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28740853 |
atttgtgttaaatagacttaggaactgattttgtctgtataatgttcatggacatgttatcaatctttgtatggctaaattttaattaagccacctagct |
28740754 |
T |
 |
| Q |
201 |
taaaagtcaaaagcaatgtattggttttgcaagagtggaataaatgtttctggacatggtgnnnnnnnccctcattgctttcttcatctct |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28740753 |
taaaagtcaaaagcaatgtattggttttgcaagagtggaataaatgtttctggacatggtgtttttttccctcattgctttcttcatctct |
28740663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University