View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13377_low_16 (Length: 246)
Name: NF13377_low_16
Description: NF13377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13377_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 13 - 224
Target Start/End: Complemental strand, 53331247 - 53331037
Alignment:
| Q |
13 |
aaaattcaactctgcaaaatgtacggtggctgccacacagaaatatctccttaatcnnnnnnnnnngacagtccaacattcattcatatcaaagaaagaa |
112 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
53331247 |
aaaattcaactctgcaaattgtacg-tggctgccacacagaaatatctccttactcttttttttttgacagtccaacattcattcatatcaaagaaagaa |
53331149 |
T |
 |
| Q |
113 |
ggttgatatatacagcagcagcttagcgccaagaacaggatcccaactagattatgagctacaccattacatcttttaatgaacataacactacaattaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53331148 |
ggttgatatatacagcagcagcttagcgccaagaacaggatcccaactagattatgagctacaccattacatcttttaatgaacataacactacaattaa |
53331049 |
T |
 |
| Q |
213 |
caatttcagaca |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
53331048 |
caatttcagaca |
53331037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University