View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13377_low_7 (Length: 399)
Name: NF13377_low_7
Description: NF13377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13377_low_7 |
 |  |
|
| [»] scaffold1301 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 32)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 25 - 232
Target Start/End: Original strand, 4497411 - 4497618
Alignment:
| Q |
25 |
gagattacatttcgttgaggaagttgatgagcttcctcttcacagttgttatggttatagaagtacttctgtaataaagctagtaataagcagattgtgg |
124 |
Q |
| |
|
||||||||||||| ||||| |||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4497411 |
gagattacatttccttgagaaagttggtgagcttcctcttcacaattgttatggttatggaagtacttctgtaataaagctagtaataagcagattgtgg |
4497510 |
T |
 |
| Q |
125 |
aagtggtagcacatatgaaatagagtacccaaaatttgtcaagggtaaggctctcagtttctggagatgctgagttgcttgagcattccttattaggtgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4497511 |
aagtggtagcacatatgaaatagagtacccaaaatttgtcaagggtaaggctctcagtttctggagatgctgagttgcttgagcattccttattaggtgt |
4497610 |
T |
 |
| Q |
225 |
taaccaat |
232 |
Q |
| |
|
|||||||| |
|
|
| T |
4497611 |
taaccaat |
4497618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 27 - 216
Target Start/End: Original strand, 4491734 - 4491923
Alignment:
| Q |
27 |
gattacatttcgttgaggaagttgatgagcttcctcttcacagttgttatggttatagaagtacttctgtaataaagctagtaataagcagattgtggaa |
126 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4491734 |
gattacatttccctgagaaagttgatgagcttgctcttcgcagttgttatggttatagaagtacttctgtaataaagctagtaataagcagattgtggaa |
4491833 |
T |
 |
| Q |
127 |
gtggtagcacatatgaaatagagtacccaaaatttgtcaagggtaaggctctcagtttctggagatgctgagttgcttgagcattcctta |
216 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||| |
|
|
| T |
4491834 |
gtggtagcacatatgaaatagagtccccaaaatttgtcaagggtaaggctctcagtttctgaagatgttgagttcattgagcattcctta |
4491923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 6403995 - 6404081
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6403995 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
6404081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 15911663 - 15911749
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15911663 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
15911749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 11 - 231
Target Start/End: Original strand, 4503977 - 4504194
Alignment:
| Q |
11 |
catcatcaaattcggagattacatttcgttgaggaagttgatgagcttcctcttcacagttgttatggttatagaagtacttctgtaataaagctagtaa |
110 |
Q |
| |
|
|||||||| |||||| |||||||||| ||||||||||||| |||| ||| ||| ||| |||||||||| ||| || ||| |||||||||||||| |
|
|
| T |
4503977 |
catcatcagattcggcaattacatttccttgaggaagttga---gcttgctcatcatagtgattatggttatggaaatatttcctcaataaagctagtaa |
4504073 |
T |
 |
| Q |
111 |
taagcagattgtggaagtggtagcacatatgaaatagagtacccaaaatttgtcaagggtaaggctctcagtttctggagatgctgagttgcttgagcat |
210 |
Q |
| |
|
|| |||||| |||||||||| ||||||||||| ||| ||| || | |||||| ||||||| || ||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
4504074 |
tatgcagatggtggaagtggcagcacatatgatatatagtcccaagaatttggcaagggtcagactctccgtttctggagatgctgagttggttgagcat |
4504173 |
T |
 |
| Q |
211 |
tccttattaggtgttaaccaa |
231 |
Q |
| |
|
|| || ||||||||||||| |
|
|
| T |
4504174 |
tcagtagaaggtgttaaccaa |
4504194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 38207364 - 38207450
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38207364 |
atatgaaccccacacaagctgcaatgcattgcaattgcaggattcctatgaacggtcaacaatgaccatgacatcatcgacacccct |
38207450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 44759972 - 44760058
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44759972 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggctcctatgaacggtcaacaatgatcatgacaccatcgacacccct |
44760058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 231 - 310
Target Start/End: Original strand, 17308833 - 17308912
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcga |
310 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17308833 |
atatgaaccccacacaagctgcaattcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcga |
17308912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 17137967 - 17137881
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
17137967 |
atatgaatcccacacaagctgcaatgcattgcaattgcagggttcctatgaactgtcaacaatgaccatgacaccatcaacacccct |
17137881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 30490938 - 30490852
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30490938 |
atatgaaccccacacaagttgcaatgcattgcaattgcagtgttcctatgaacggtcaacaatgaccatggcaccatcgacacccct |
30490852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 18137474 - 18137555
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18137474 |
atatgaaccccacacaagctgcaatgca-----attgcagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
18137555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 13278579 - 13278660
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13278579 |
atatgaaccccacacaagctgcaatgct-----attgcagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
13278660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 7942994 - 7942913
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||| ||||| |||| |
|
|
| T |
7942994 |
atatgaaccccacacaagctgcaatgca-----attgcagggttcatatgaacagtcaacaatgaccatgacaccaccgacaaccct |
7942913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 231 - 305
Target Start/End: Original strand, 1114648 - 1114717
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacc |
305 |
Q |
| |
|
|||||||| ||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1114648 |
atatgaaccccacacaagctgcaatgaa-----attgcagggttcatatgaacggtcaacaatgaccatgacacc |
1114717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 264 - 317
Target Start/End: Complemental strand, 1210155 - 1210102
Alignment:
| Q |
264 |
attgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
1210155 |
attgcagggttcatatgaacggtcaacaatgaccatgacaccaccaacacccct |
1210102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 272 - 317
Target Start/End: Complemental strand, 38703803 - 38703758
Alignment:
| Q |
272 |
gttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38703803 |
gttcctatgaacggtcaacaattaccatgacaccatcgacacccct |
38703758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 231 - 283
Target Start/End: Original strand, 45116964 - 45117016
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaac |
283 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45116964 |
atattaaccccacacaagctgcaatgcattgcaattgcagggttcttatgaac |
45117016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 231 - 277
Target Start/End: Complemental strand, 38707472 - 38707426
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcct |
277 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38707472 |
atatgaaccccacataagctgcaatgcattgcaattgcagggttcct |
38707426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 5939310 - 5939259
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
5939310 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
5939259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 24168410 - 24168461
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
24168410 |
tgcaatgcaattgcagaggtcgtatgaacggtcaacaatgaccatgacacca |
24168461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 31994310 - 31994259
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||| |||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31994310 |
tgcaatgctattgcatggttcatatgaacggtcaacaatgaccatgacacca |
31994259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 34948385 - 34948436
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
34948385 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
34948436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 306
Target Start/End: Original strand, 45526222 - 45526268
Alignment:
| Q |
260 |
tgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
45526222 |
tgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
45526268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 11 - 54
Target Start/End: Original strand, 4497295 - 4497338
Alignment:
| Q |
11 |
catcatcaaattcggagattacatttcgttgaggaagttgatga |
54 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||||||||| |
|
|
| T |
4497295 |
catcatcagattcggagattacgtttccttgaggaagttgatga |
4497338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 5464615 - 5464564
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| | |||||||||||||||||||||| |
|
|
| T |
5464615 |
tgcaatgcaattgcaggggtcgtatgagcagtcaacaatgaccatgacacca |
5464564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 263 - 306
Target Start/End: Complemental strand, 16252588 - 16252545
Alignment:
| Q |
263 |
aattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
||||||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
16252588 |
aattgcaaggctcgtatgaacggtcaacaatgaccatgacacca |
16252545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 263 - 306
Target Start/End: Original strand, 16414228 - 16414271
Alignment:
| Q |
263 |
aattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
||||||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
16414228 |
aattgcaagggtcgtatgaacggtcaacaatgaccatgacacca |
16414271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 16739616 - 16739565
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||| | || |||||| ||||||||||||||||||||||| |
|
|
| T |
16739616 |
tgcaatgcaattgcagaggtcgtatgaatggtcaacaatgaccatgacacca |
16739565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 18963248 - 18963299
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
18963248 |
tgcaatgcaattgcaggggttgtatgaatggtcaacaatgaccatgacacca |
18963299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 34906239 - 34906290
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || | ||| |||||||||||||||||||||||| |
|
|
| T |
34906239 |
tgcaatgcaattgcaggggtcgtgtgagcggtcaacaatgaccatgacacca |
34906290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 41961596 - 41961647
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
41961596 |
tgcaatgcaattgcaggggtcgtatgagaggtcaacaatgaccatgacacca |
41961647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 306
Target Start/End: Complemental strand, 21485484 - 21485439
Alignment:
| Q |
261 |
gcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||||||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
21485484 |
gcaattgcaggggttatatgaatggtcaacaatgaccatgacacca |
21485439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 83; Significance: 3e-39; HSPs: 11)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 16395195 - 16395281
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16395195 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
16395281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 31271229 - 31271315
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31271229 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgatacccct |
31271315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 303634 - 303720
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303634 |
atatgaaccccgcacaagctgcaatgcattgcaattgcagagttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
303720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 231 - 314
Target Start/End: Complemental strand, 31723129 - 31723046
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacc |
314 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31723129 |
atatgaactccacacaagctgcaacgcattgcaattgtagggttcttatgaacggtcaacaatgaccatgacaccatcgacacc |
31723046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 231 - 313
Target Start/End: Original strand, 438911 - 438993
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacac |
313 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
438911 |
atataaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaataatgaccatgacaccatcgacac |
438993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 13036794 - 13036845
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
13036794 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
13036845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 231 - 306
Target Start/End: Original strand, 31318408 - 31318478
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
31318408 |
atatgaaccccacacaagctgcaatgct-----attgcagggtttatatgaacggtcaacaatgactatgacacca |
31318478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 9305215 - 9305134
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||| | ||| ||||||||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
9305215 |
atatgaaccccacacaagctgcaatgct-----attgcaagattcatatgaacggtcaacaataaccatgacaccaccgatacccct |
9305134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 12305315 - 12305267
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgaca |
303 |
Q |
| |
|
|||| ||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
12305315 |
tgcaatgcaattgcaggggtcgaatgaacggtcaacaatgaccatgaca |
12305267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 29436000 - 29436051
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| |||||||| |||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
29436000 |
tgcaatgcaattgtaggggtcgtatgagcggtcaacaatgaccatgacacca |
29436051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 34949434 - 34949482
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgaca |
303 |
Q |
| |
|
|||| ||||||||||||| || ||||| ||||||||||||| ||||||| |
|
|
| T |
34949434 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgatcatgaca |
34949482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 83; Significance: 3e-39; HSPs: 25)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 27114184 - 27114270
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27114184 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
27114270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 8301020 - 8300934
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8301020 |
atataaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
8300934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 38679710 - 38679624
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38679710 |
atatgaaccccacacaagctgcaatgcattgcaattgcaggcttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
38679624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 3556501 - 3556587
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3556501 |
atatgaacctcacacaagctgcaatgcattgcaattgcaaggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
3556587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 8734574 - 8734660
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8734574 |
atatgaaccccacacaagctgcattgcattgcaattgcatggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
8734660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 13822330 - 13822244
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13822330 |
atatgaaccccacacaagttgcaatgcattgcaattgcagggtttctatgaacggtcaacaatgaccatgacaccatcgacacccct |
13822244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 18808859 - 18808945
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18808859 |
atatgaaccccacacaagctgcaatgcattgcaattgcaaggttcctatgtacggtcaacaatgaccatgacaccatcgacacccct |
18808945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 242 - 317
Target Start/End: Original strand, 12723562 - 12723637
Alignment:
| Q |
242 |
acacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12723562 |
acacaagttgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
12723637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 242 - 317
Target Start/End: Original strand, 12785045 - 12785120
Alignment:
| Q |
242 |
acacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12785045 |
acacaagttgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
12785120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 8197288 - 8197374
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8197288 |
atatgaaccccacataagctgcaatgcattgcaattgcatggttcctatgaacagtcaacaatgaccatgacaccatcgacacccct |
8197374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 16513851 - 16513765
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16513851 |
atataaaccccacacaagctgcaatgcattgcaattgcagggttcctattaacggtcaacaatgaccatgacaccattgacacccct |
16513765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 240 - 317
Target Start/End: Original strand, 37012713 - 37012790
Alignment:
| Q |
240 |
ccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37012713 |
ccacacaagctacaatgcattgcaattgcagggtttctatgaacggtcaacaatgaccatgacaccatcgacacccct |
37012790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 255 - 317
Target Start/End: Complemental strand, 37030487 - 37030425
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||| ||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37030487 |
tgcaatgctattgcagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
37030425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 233 - 317
Target Start/End: Original strand, 26278922 - 26279001
Alignment:
| Q |
233 |
atgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||| ||||||||||||||||||| | |||||||||| |||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
26278922 |
atgaaccccacacaagctgcaatgcact-----tgcagggttcatatgaatggtcaacaatgaccatgacaccaccgacacccct |
26279001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 15858730 - 15858778
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgaca |
303 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
15858730 |
tgcattgcaattgcatggttcctatgaacggtcaacgatgaccatgaca |
15858778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 231 - 315
Target Start/End: Complemental strand, 25977383 - 25977304
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacaccc |
315 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||| ||||| ||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
25977383 |
atatgaaccccacacaagctgcaatgca-----attgcaaggttcatatgaacggtcaacaatgaccgtgacaccactgacaccc |
25977304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 231 - 314
Target Start/End: Complemental strand, 2606240 - 2606162
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacc |
314 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||| |||||| | ||||||||||||||||||||| ||||||| |
|
|
| T |
2606240 |
atatgaaccccacacaagctgcaatgct-----attgcagggttcatatgaatgatcaacaatgaccatgacaccaccgacacc |
2606162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 264 - 306
Target Start/End: Complemental strand, 9715536 - 9715494
Alignment:
| Q |
264 |
attgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9715536 |
attgcagggttcatatgaacggtcaacaatgaccatgacacca |
9715494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 264 - 305
Target Start/End: Original strand, 37883338 - 37883379
Alignment:
| Q |
264 |
attgcagggttcctatgaacggtcaacaatgaccatgacacc |
305 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37883338 |
attgcagggttcatatgaacggtcaacaatgaccatgacacc |
37883379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 1711449 - 1711398
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
1711449 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
1711398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 6432643 - 6432592
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
6432643 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
6432592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 24856145 - 24856094
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
24856145 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
24856094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 31471756 - 31471705
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
31471756 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
31471705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 261 - 306
Target Start/End: Original strand, 23252385 - 23252430
Alignment:
| Q |
261 |
gcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
23252385 |
gcaattgcaggggttatatgaacggtcaacaatgaccatgacacca |
23252430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 260 - 306
Target Start/End: Original strand, 32746748 - 32746794
Alignment:
| Q |
260 |
tgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
||||||||||||| || ||||| | |||||||||||||||||||||| |
|
|
| T |
32746748 |
tgcaattgcaggggtcgtatgagcagtcaacaatgaccatgacacca |
32746794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 83; Significance: 3e-39; HSPs: 32)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 39586453 - 39586539
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586453 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
39586539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 149207 - 149292
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149207 |
atatgaac-ccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
149292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 40937097 - 40937183
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40937097 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttccgatgaacggtcaacaatgaccatgacaccatcgacacccct |
40937183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 47646795 - 47646881
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47646795 |
atatgaaccccacacaagctgcaatgcattgcaactgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
47646881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 231 - 314
Target Start/End: Complemental strand, 10509479 - 10509396
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacc |
314 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10509479 |
atatgaaccccagacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacc |
10509396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 227509 - 227595
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
227509 |
atatgaaccccacacaagctgcaatgcattgtaattgcagggttcctatgaacggtcgacaatgaccatgacaccatcgacacccct |
227595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 26502449 - 26502363
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26502449 |
atatgaaccccgcacaagctgcaatacattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
26502363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 231 - 315
Target Start/End: Complemental strand, 36402967 - 36402883
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacaccc |
315 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36402967 |
atatgaaccccacacaagctgtaatgtattgcaattgcacggttcctatgaacggtcaacaatgaccatgacaccatggacaccc |
36402883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 41193974 - 41193888
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||| |||||||||| |||||||||| |
|
|
| T |
41193974 |
atatgaaccccacacaagctgcaatgcattgcaattacagggttcccatgaacgatcaacaatgatcatgacaccaccgacacccct |
41193888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 231 - 305
Target Start/End: Original strand, 41174699 - 41174773
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacc |
305 |
Q |
| |
|
|||||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41174699 |
atatgaacctcacataagctacaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacc |
41174773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 47013974 - 47013888
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| ||||||||| ||||||||| |
|
|
| T |
47013974 |
atatgaaccccacacaagctgcaatgcatttgaattgcagggttcctatgaacggtcaacagcgaccgtgacaccatagacacccct |
47013888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 31765454 - 31765373
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
31765454 |
atatgaaccccacacaagctgcaatgca-----attgcagggttcatatgaatggtcaacaatgaccatgacaccactgacacccct |
31765373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 231 - 306
Target Start/End: Complemental strand, 49166361 - 49166291
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49166361 |
atatgaaccccacacaagctgcaatgca-----attgcatggttcatatgaacggtcaacaatgaccatgacacca |
49166291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 2182983 - 2183034
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
2182983 |
tgcaatgcaattgcaggggtcgtatgaacggtcaacaatgaccatgacacca |
2183034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 260 - 304
Target Start/End: Complemental strand, 26982552 - 26982508
Alignment:
| Q |
260 |
tgcaattgcagggttcctatgaacggtcaacaatgaccatgacac |
304 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
26982552 |
tgcaattgcaggggtcgtatgaacggtcaacaatgaccatgacac |
26982508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 8486739 - 8486688
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
8486739 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
8486688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 21980131 - 21980080
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
21980131 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
21980080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 22002562 - 22002511
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
22002562 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
22002511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 270 - 317
Target Start/End: Original strand, 39353217 - 39353264
Alignment:
| Q |
270 |
gggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
39353217 |
gggttcatatgaacggtcaacaatgaccatgacatcaccgacacccct |
39353264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 49327546 - 49327495
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
49327546 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
49327495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 53393850 - 53393901
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| |||||||||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
53393850 |
tgcaatgcaattgcatgggtcgtatgaacggtcaacaatgaccatgacacca |
53393901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 271 - 317
Target Start/End: Original strand, 32529720 - 32529766
Alignment:
| Q |
271 |
ggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
32529720 |
ggttcatatgaacggtcaacaatgaccatgacaccaccaacacccct |
32529766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 261 - 306
Target Start/End: Complemental strand, 10494944 - 10494899
Alignment:
| Q |
261 |
gcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
10494944 |
gcaattgcaggggttatatgaacggtcaacaatgaccatgacacca |
10494899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 9126933 - 9126984
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || |||||||| |||||||||||||||| |||| |
|
|
| T |
9126933 |
tgcaatgcaattgcaggggtcgtatgaacgatcaacaatgaccatgaaacca |
9126984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 9135040 - 9135091
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || |||||||| |||||||||||||||| |||| |
|
|
| T |
9135040 |
tgcaatgcaattgcaggggtcgtatgaacgatcaacaatgaccatgaaacca |
9135091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 18875933 - 18875984
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
18875933 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccattacacca |
18875984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 21450393 - 21450342
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || |||| |||||||||||||||||||||||| |
|
|
| T |
21450393 |
tgcaatgcaattgcaggggtcacatgagcggtcaacaatgaccatgacacca |
21450342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 306
Target Start/End: Original strand, 12717578 - 12717607
Alignment:
| Q |
277 |
tatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12717578 |
tatgaacggtcaacaatgaccatgacacca |
12717607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 306
Target Start/End: Original strand, 33843423 - 33843468
Alignment:
| Q |
261 |
gcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
33843423 |
gcaattgcaggggttatatgaacgatcaacaatgaccatgacacca |
33843468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 255 - 317
Target Start/End: Original strand, 6936375 - 6936434
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||| |||||||||||||||| ||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
6936375 |
tgcaatgcaattgcagggttcatatgaacagt---caatgaccatgacaccactgacacccct |
6936434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 44207821 - 44207773
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgaca |
303 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||| |||||| |
|
|
| T |
44207821 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgactatgaca |
44207773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 262 - 306
Target Start/End: Original strand, 48062086 - 48062130
Alignment:
| Q |
262 |
caattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
||||||||| | || ||||| |||||||||||||||||||||||| |
|
|
| T |
48062086 |
caattgcagaggtcgtatgagcggtcaacaatgaccatgacacca |
48062130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 82; Significance: 1e-38; HSPs: 33)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 231 - 316
Target Start/End: Original strand, 33801242 - 33801327
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccc |
316 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33801242 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccc |
33801327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 231 - 316
Target Start/End: Complemental strand, 44757789 - 44757704
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccc |
316 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44757789 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccc |
44757704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 22858638 - 22858724
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22858638 |
atatgaaccccacacaagctgcaatgcattgcaattacagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
22858724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 29961277 - 29961363
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29961277 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctattaacggtcaacaatgaccatgacaccatcgacacccct |
29961363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 41723408 - 41723494
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41723408 |
atatgaaccccacacaagctacaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
41723494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 241 - 317
Target Start/End: Original strand, 44496375 - 44496451
Alignment:
| Q |
241 |
cacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44496375 |
cacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
44496451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 3517833 - 3517747
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3517833 |
atatgaacctcacacaagctgcaatgcattgcaattgcagggttcatatgaacggtcaacaatgaccatgacaccatcgacacccct |
3517747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 37952180 - 37952266
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
37952180 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcttatgaacggtcaacaatgaccatgacaacatcaacacccct |
37952266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 42882847 - 42882762
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
42882847 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggtt-ctatgaacggtcatcaatgaccataacaccatcgacacccct |
42882762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 14587601 - 14587515
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||| |||||||||| ||||||||| |||||||||||| |||||||| |
|
|
| T |
14587601 |
atatgaaccccacacaagctgcaatgcattgcaattgtagggtttctatgaacggccaacaatgatcatgacaccatcaacacccct |
14587515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 231 - 305
Target Start/End: Complemental strand, 48965149 - 48965075
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacc |
305 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
48965149 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaatggtcaacaatgacaatgacacc |
48965075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 12700801 - 12700711
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaac----aatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
12700801 |
atatgaaccccacacaagctgcaatgcattgcaattgcatggttcctatgaacggtcaacaattaatgaccatgacaccaccgacacccct |
12700711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 41900540 - 41900459
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41900540 |
atatgaaccccacacaagctgcaatgct-----attgcagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
41900459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 27216684 - 27216765
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||| ||||||||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
27216684 |
atatgaacgccacacaagctgcaatgca-----attgcagggttcatatgaacggtcaacaatcaccaagacaccaccgacacccct |
27216765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 255 - 317
Target Start/End: Original strand, 41086304 - 41086366
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||| ||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41086304 |
tgcaatgctattgcagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
41086366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 255 - 317
Target Start/End: Original strand, 41091072 - 41091134
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||| ||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41091072 |
tgcaatgctattgcagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
41091134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 260 - 317
Target Start/End: Original strand, 49851618 - 49851675
Alignment:
| Q |
260 |
tgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
49851618 |
tgcaattgcagggttcatatgaacggacaacaatgaccatgacaccaccgacacccct |
49851675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 231 - 315
Target Start/End: Complemental strand, 11952673 - 11952594
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacaccc |
315 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
11952673 |
atatgaaccccacacaagctgcaatgct-----attgcagggttcatatgaacggtcaacaatgaccataacaccaccgacaccc |
11952594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 255 - 314
Target Start/End: Original strand, 38860581 - 38860640
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacc |
314 |
Q |
| |
|
|||| |||||||||||| ||| |||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
38860581 |
tgcaatgcaattgcaggattcatatgaacggtcaacaatgacgatgacaccaccgacacc |
38860640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 255 - 317
Target Start/End: Complemental strand, 23984269 - 23984207
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||| ||| |||||| |||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23984269 |
tgcaatgctattgcaaggtttatatgaacggtcaacaatgaccatgacaccaccgacacccct |
23984207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 264 - 305
Target Start/End: Original strand, 12528359 - 12528400
Alignment:
| Q |
264 |
attgcagggttcctatgaacggtcaacaatgaccatgacacc |
305 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12528359 |
attgcagggttcatatgaacggtcaacaatgaccatgacacc |
12528400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 10223400 - 10223349
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
10223400 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
10223349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 12525138 - 12525087
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
12525138 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
12525087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 18272171 - 18272222
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
18272171 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
18272222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 18276825 - 18276876
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
18276825 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
18276876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 22335134 - 22335083
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
22335134 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
22335083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 39598115 - 39598166
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
39598115 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
39598166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 3475498 - 3475447
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||| ||||||||| |
|
|
| T |
3475498 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgacaatgacacca |
3475447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 5750026 - 5749975
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| | |||||||||||||||||||||| |
|
|
| T |
5750026 |
tgcaatgcaattgcaggggtcgtatgagcagtcaacaatgaccatgacacca |
5749975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 22817707 - 22817656
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| ||| |||||||||||||||||||| |
|
|
| T |
22817707 |
tgcaatgcaattgcaggggtcgtatgagcggacaacaatgaccatgacacca |
22817656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 304
Target Start/End: Original strand, 21187398 - 21187447
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacac |
304 |
Q |
| |
|
|||| |||| |||||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
21187398 |
tgcaatgcagttgcaggggtcgtatgagcggtcaacaatgaccatgacac |
21187447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 307
Target Start/End: Complemental strand, 41933698 - 41933653
Alignment:
| Q |
262 |
caattgcagggttcctatgaacggtcaacaatgaccatgacaccat |
307 |
Q |
| |
|
|||||||| || | ||||||||||||| |||||||||||||||||| |
|
|
| T |
41933698 |
caattgcaaggattctatgaacggtcatcaatgaccatgacaccat |
41933653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 317
Target Start/End: Complemental strand, 52632582 - 52632529
Alignment:
| Q |
264 |
attgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||| ||||| |||||||||| |
|
|
| T |
52632582 |
attgcagggttcatatgaacagacaacaatgaccataacacctccgacacccct |
52632529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 79; Significance: 8e-37; HSPs: 24)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 39260550 - 39260464
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39260550 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttactatgaacggtcaacaatgaccatgacaccatcgacacccct |
39260464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 40105506 - 40105420
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40105506 |
atatgaaccccacacaaactgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
40105420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 8240245 - 8240159
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8240245 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcatatgaacggtcaacaatgatcatgacaccatcgacacccct |
8240159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 32946959 - 32947045
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32946959 |
atatgaaccccacacaagctgcaatgcattgcaattggagagttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
32947045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 35684273 - 35684187
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35684273 |
atatgaaccccacacaagctgcaatgcattgcaattgcagagttcctatgaacggtcaacaatgaccatgacaccatcgatacccct |
35684187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 42132125 - 42132039
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42132125 |
atatgaacccgacacaagctgcaatgcattgcaattgcagggttcatatgaacggtcaacaatgaccatgacaccatcgacacccct |
42132039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 39318853 - 39318767
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39318853 |
atatgaatcccacaaaagttgcaatgcattgcaattgcatggttcctatgaacggtcaacaatgactatgacaccatcgacacccct |
39318767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 32337693 - 32337777
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32337693 |
atatgaacctcacacaagctgcaatgc--tgcaattgcagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
32337777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 231 - 315
Target Start/End: Complemental strand, 586663 - 586584
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacaccc |
315 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
586663 |
atatgaaccccacacaagctgcaatgca-----attgcagggttcatatgaacggtcaacaatgaccatggcaccaccgacaccc |
586584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 29544284 - 29544365
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||| | |||||||| |
|
|
| T |
29544284 |
atatgaactccacacaagctgcaatgct-----attgcagggttcatatgaacggtcaacaatgaccatgataccaccaacacccct |
29544365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 37098221 - 37098302
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||| || |||| ||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37098221 |
atatgaaccccacacaagctgcaatg--tt---attgtagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
37098302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 231 - 315
Target Start/End: Original strand, 627260 - 627339
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacaccc |
315 |
Q |
| |
|
|||||||| ||||||||||| ||||||| |||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
627260 |
atatgaaccccacacaagcttcaatgca-----attgcagggttcatatgaacggtcaacaatgaccatggcaccaccgacaccc |
627339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 231 - 306
Target Start/End: Complemental strand, 31701307 - 31701237
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31701307 |
atatgaaccccacacaagctgcaatgct-----attgcagggttcatatgaacggtcaacaatgaccatgacacca |
31701237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 255 - 317
Target Start/End: Complemental strand, 13546422 - 13546360
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||| ||| |||| ||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13546422 |
tgcaatgctattgaagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
13546360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 255 - 317
Target Start/End: Original strand, 13678051 - 13678113
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||| ||| |||| ||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13678051 |
tgcaatgctattgaagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
13678113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 43098797 - 43098716
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||||||||| |||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
43098797 |
atatgaaccccacacaagctgcaatact-----attgcagggttcatatgaacggtaaacaatgaccatgacaccaccgacacccct |
43098716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 273 - 317
Target Start/End: Original strand, 11076150 - 11076194
Alignment:
| Q |
273 |
ttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11076150 |
ttcctatgaacggtcaacaatgatcatgacaccatcgacacccct |
11076194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 231 - 306
Target Start/End: Original strand, 20091447 - 20091517
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||||| ||||||||||| |||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20091447 |
atatgaaccccacacaagctacaatgct-----attgcagggttcatatgaacggtcaacaatgaccatgacacca |
20091517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 23144360 - 23144279
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||||||||| ||||||| |||||||||||||||||||| | |||||||||| |
|
|
| T |
23144360 |
atatgaaccccacacaagctgcaattct-----attgcagggttcatatgaacagtcaacaatgaccatgacacaaccgacacccct |
23144279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 42190450 - 42190501
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
42190450 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
42190501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 255 - 304
Target Start/End: Complemental strand, 23421181 - 23421132
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacac |
304 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
23421181 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacac |
23421132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 262 - 306
Target Start/End: Complemental strand, 21269216 - 21269172
Alignment:
| Q |
262 |
caattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
21269216 |
caattgcaggggttatatgaacggtcaacaatgaccatgacacca |
21269172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 11959 - 11908
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| | |||||||||||||||||||||| |
|
|
| T |
11959 |
tgcaatgcaattgcaggggtcatatgagcagtcaacaatgaccatgacacca |
11908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 306
Target Start/End: Complemental strand, 4258938 - 4258893
Alignment:
| Q |
261 |
gcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
||||||||| || || ||||||| |||||||||||||||||||||| |
|
|
| T |
4258938 |
gcaattgcatgggtcatatgaacagtcaacaatgaccatgacacca |
4258893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 79; Significance: 8e-37; HSPs: 20)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 34848132 - 34848046
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34848132 |
atatgaaccccacacaagctgcaatgcattgcaattgtagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
34848046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 35794357 - 35794443
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35794357 |
atatgaaccccacacaagctgcaatgcattgcaatcgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
35794443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 36312339 - 36312253
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36312339 |
atatgaaccccacataagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccattgacacccct |
36312253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 25529363 - 25529278
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25529363 |
atatgaac-ccacacaagctgcaatacattgcaattgcagggttcttatgaacggtcaacaatgaccatgacaccatcgacacccct |
25529278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 235 - 317
Target Start/End: Original strand, 46254750 - 46254832
Alignment:
| Q |
235 |
gaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
46254750 |
gaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacgttcaacaatgaccatgacaccatcgacatccct |
46254832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 33950810 - 33950896
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33950810 |
atatgaaccccacacaagttaaaatgcattgcaattgcagggttcatatgaacggtcaacaatgaccatgacaccatcgacacccct |
33950896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 43458067 - 43458153
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
43458067 |
atatgaaccccacacaaactgcaatgcattgctattgcagggttcctatgaacggtcaacaatgaccataacaccatcaacacccct |
43458153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 44862897 - 44862982
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44862897 |
atatgaaccccacacaaactgcaatgcattgaaattgcagggttc-tatgaacggtcaacaatgaccatgacaccatcgacacccct |
44862982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 231 - 314
Target Start/End: Complemental strand, 14816904 - 14816826
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacc |
314 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14816904 |
atatgaaccccacacaagctgcaatgct-----attgcagggttcatatgaacggtcaacaatgaccatgacaccaccgacacc |
14816826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 231 - 314
Target Start/End: Complemental strand, 15263900 - 15263822
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacc |
314 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15263900 |
atatgaaccccacacaagctgcaatgct-----attgcagggttcatatgaacggtcaacaatgaccatgacaccaccgacacc |
15263822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 231 - 314
Target Start/End: Complemental strand, 42321384 - 42321306
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacc |
314 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
42321384 |
atatgaaccacacacaagctgcaa-----tgcaattgcagggttcatatgaacggtcaacaatgaccatgaaaccaccgacacc |
42321306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 15032774 - 15032723
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
15032774 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
15032723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 38257665 - 38257614
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
38257665 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
38257614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 43749424 - 43749373
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
43749424 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
43749373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 306
Target Start/End: Original strand, 108610 - 108656
Alignment:
| Q |
260 |
tgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
108610 |
tgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
108656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 261 - 306
Target Start/End: Original strand, 1852055 - 1852100
Alignment:
| Q |
261 |
gcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
1852055 |
gcaattgcaggggttatatgaacggtcaacaatgaccatgacacca |
1852100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 255 - 305
Target Start/End: Complemental strand, 29739432 - 29739382
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacc |
305 |
Q |
| |
|
|||| |||||||| |||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
29739432 |
tgcaatgcaattgtaggggtcgtatgagcggtcaacaatgaccatgacacc |
29739382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 262 - 304
Target Start/End: Original strand, 37998579 - 37998621
Alignment:
| Q |
262 |
caattgcagggttcctatgaacggtcaacaatgaccatgacac |
304 |
Q |
| |
|
||||||||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
37998579 |
caattgcaggggtcgtatgagcggtcaacaatgaccatgacac |
37998621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 306
Target Start/End: Original strand, 1869306 - 1869351
Alignment:
| Q |
261 |
gcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
1869306 |
gcaattgcaggagttatatgaacggtcaacaatgaccatgacacca |
1869351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 35585293 - 35585241
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatga-ccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| ||||||||||||| ||||||||||| |
|
|
| T |
35585293 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgacccatgacacca |
35585241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 8e-37; HSPs: 40)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 31092986 - 31093072
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31092986 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcaacacccct |
31093072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 40727905 - 40727991
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40727905 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcttatgaacggtcaacaatgaccatgacaccatcgacacccct |
40727991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 45461376 - 45461462
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45461376 |
atatgaaccccacacaagctacaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
45461462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 231 - 312
Target Start/End: Complemental strand, 43842135 - 43842054
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgaca |
312 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43842135 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgaca |
43842054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 231 - 315
Target Start/End: Original strand, 51538525 - 51538609
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacaccc |
315 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51538525 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaatggtcaacaatgaccatgacaccatcgacaccc |
51538609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 16023753 - 16023839
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16023753 |
atatgaaccccacacaagctacaatgcattgcaattgcaaggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
16023839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 35158599 - 35158685
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35158599 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcttatgaacggtcaacaatgaccatgacaccatcgacgcccct |
35158685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 38218525 - 38218439
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38218525 |
atatgaaccacacacaagctgcaatgcattgcaattgtagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
38218439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 240 - 317
Target Start/End: Original strand, 55136554 - 55136631
Alignment:
| Q |
240 |
ccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55136554 |
ccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaataatgaccatgacaccatcgacacccct |
55136631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 30003491 - 30003577
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30003491 |
atatgaaccccacacaagctgcaatgcattgcaattgtagtgttcttatgaacggtcaacaatgaccatgacaccatcgacacccct |
30003577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 45029278 - 45029192
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45029278 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctataaacggtcaacaactaccatgacaccatcgacacccct |
45029192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 52417191 - 52417105
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||| |
|
|
| T |
52417191 |
atatgaaccccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacgataatcatgacaccatcgacacccct |
52417105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 240 - 317
Target Start/End: Original strand, 45228959 - 45229035
Alignment:
| Q |
240 |
ccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45228959 |
ccacacaagctgcaatg-attgcaattgcagggttcctataaacggtcaacaatgaccatgacaccatcgacacccct |
45229035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 231 - 315
Target Start/End: Original strand, 33280967 - 33281051
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacaccc |
315 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33280967 |
atattaaccccacacaagccgcaatgcattgcaattgaagggttcctatgaacggttaacaatgaccatgacaccatcgacaccc |
33281051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 231 - 311
Target Start/End: Complemental strand, 56463899 - 56463819
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgac |
311 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
56463899 |
atatgaaccccacacaaactgcaatgcattgcaattgcatggttcctatgaacggtcaacaatgagcatgacaccatcgac |
56463819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 9036357 - 9036271
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9036357 |
atatgaaccccacacaagctgcaatgcgttgcaattttaggattcctatgaacggtcaacaatgaccatgacaccattgacacccct |
9036271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 1602666 - 1602750
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| | |||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
1602666 |
atatgaaccctacacaagc--caatgcattgcaactgcagggttcctatgaacggtcagcaatgaccatgacactatcgacacccct |
1602750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 45924484 - 45924565
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45924484 |
atatgaaccccacacaagctgcaatgct-----attgcagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
45924565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 49374204 - 49374285
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49374204 |
atatgaaccccacacaagctgcaatgct-----attgcagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
49374285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 264 - 317
Target Start/End: Complemental strand, 28781000 - 28780947
Alignment:
| Q |
264 |
attgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28781000 |
attgcagggttcctctgaacggtcaacaatgaccatgacaccatcgacacccct |
28780947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 255 - 317
Target Start/End: Complemental strand, 4190107 - 4190045
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||| ||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4190107 |
tgcaatgctattgcagggttcatatgaacggtcaacaatgaccatgacaccaccgacacccct |
4190045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 231 - 317
Target Start/End: Original strand, 6963340 - 6963421
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
6963340 |
atatgaaccccacacaagctgcaatgct-----attgcagggttcatatgaacggttaacaatgaccatgacaccactgacacccct |
6963421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 28311143 - 28311062
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||| || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28311143 |
atatgaaccccacacaagctgcaatg--tt---attgcagggctcacatgaacggtcaacaatgaccatgacaccaccgacacccct |
28311062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 231 - 317
Target Start/End: Complemental strand, 38551520 - 38551439
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||| ||||||||||||||||| || |||||||||||| ||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
38551520 |
atatgaaccccacacaagctgcaatg--tt---attgcagggttcatatgaacggtcgagaatgaccatgacaccaccgacacccct |
38551439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 255 - 317
Target Start/End: Original strand, 16451835 - 16451897
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||| ||| |||| ||||||| ||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
16451835 |
tgcaatgctattgtagggttcatatgaacggtcaacaatgaccatgataccaccgacacccct |
16451897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 264 - 317
Target Start/End: Complemental strand, 168764 - 168711
Alignment:
| Q |
264 |
attgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||| | |||||||| |
|
|
| T |
168764 |
attgcagggttcatatgaacggtcaacaatgaccatgaccccaccaacacccct |
168711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 264 - 317
Target Start/End: Complemental strand, 2013957 - 2013904
Alignment:
| Q |
264 |
attgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
||||||| |||| |||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
2013957 |
attgcagagttcatatgaatggtcaacaatgaccatgacaccaccgacacccct |
2013904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 255 - 315
Target Start/End: Complemental strand, 15543073 - 15543013
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacaccc |
315 |
Q |
| |
|
|||| ||||||| ||||||| |||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
15543073 |
tgcaatgcaattctagggttcatatgaacggtcaacaatgaccatgacacaaccgacaccc |
15543013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 231 - 313
Target Start/End: Original strand, 4048018 - 4048096
Alignment:
| Q |
231 |
atatgaactccacacaagctgcaatgcattgcaattgcagggttcctatgaa-cggtcaacaatgaccatgacaccatcgacac |
313 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||| ||| || | |||||||||||||||||||||| |||||| |
|
|
| T |
4048018 |
atatgaaccccacacaagctgcaatgca-----attgcagggttcatataaaacagtcaacaatgaccatgacaccaccgacac |
4048096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 47985912 - 47985861
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
47985912 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
47985861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 53511427 - 53511478
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
53511427 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaatgaccatgacacca |
53511478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 261 - 305
Target Start/End: Complemental strand, 34953790 - 34953746
Alignment:
| Q |
261 |
gcaattgcagggttcctatgaacggtcaacaatgaccatgacacc |
305 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
34953790 |
gcaattgcagggattatatgaacggtcaacaatgaccatgacacc |
34953746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 17647095 - 17647146
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| | ||||| |||||||||||||||||||||||| |
|
|
| T |
17647095 |
tgcaatgcaattgcaggggtagtatgagcggtcaacaatgaccatgacacca |
17647146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 38990883 - 38990832
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| |||||||||| || || ||||| |||||||||||||||||||||||| |
|
|
| T |
38990883 |
tgcaatgcaattgcaagggtcgtatgagcggtcaacaatgaccatgacacca |
38990832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 306
Target Start/End: Complemental strand, 40693213 - 40693162
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||| | || ||||| |||||||||||||||||||||||| |
|
|
| T |
40693213 |
tgcaatgcaattgcagaggtcgtatgagcggtcaacaatgaccatgacacca |
40693162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 277 - 307
Target Start/End: Original strand, 20516592 - 20516622
Alignment:
| Q |
277 |
tatgaacggtcaacaatgaccatgacaccat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20516592 |
tatgaacggtcaacaatgaccatgacaccat |
20516622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 306
Target Start/End: Complemental strand, 39807504 - 39807459
Alignment:
| Q |
261 |
gcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| |||||||||| |
|
|
| T |
39807504 |
gcaattgcaggggttatatgaacggtcaacaatgatcatgacacca |
39807459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 253 - 306
Target Start/End: Original strand, 51889009 - 51889062
Alignment:
| Q |
253 |
aatgcattgcaattgcagggttcctatgaacggtcaacaatgaccatgacacca |
306 |
Q |
| |
|
|||||| ||||||||||||| || ||| | |||||||||||||| ||||||||| |
|
|
| T |
51889009 |
aatgcaatgcaattgcaggggtcgtataagcggtcaacaatgactatgacacca |
51889062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 13721248 - 13721300
Alignment:
| Q |
255 |
tgcattgcaattgcagggttcctatgaacggtcaac-aatgaccatgacacca |
306 |
Q |
| |
|
|||| ||||||||||||| || ||||| |||||||| |||||||||||||||| |
|
|
| T |
13721248 |
tgcaatgcaattgcaggggtcgtatgagcggtcaacaaatgaccatgacacca |
13721300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 261 - 305
Target Start/End: Original strand, 56084024 - 56084068
Alignment:
| Q |
261 |
gcaattgcagggttcctatgaacggtcaacaatgaccatgacacc |
305 |
Q |
| |
|
|||||||||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
56084024 |
gcaattgcagggattttatgaacggtcgacaatgaccatgacacc |
56084068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1301 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold1301
Description:
Target: scaffold1301; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 264 - 317
Target Start/End: Original strand, 1569 - 1622
Alignment:
| Q |
264 |
attgcagggttcctatgaacggtcaacaatgaccatgacaccatcgacacccct |
317 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||| |||||| |||||||||| |
|
|
| T |
1569 |
attgcagggttcatatgaatggtcaacaatgaccataacaccaccgacacccct |
1622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University