View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13378_high_5 (Length: 250)
Name: NF13378_high_5
Description: NF13378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13378_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 49732480 - 49732703
Alignment:
| Q |
18 |
taattatgggatcgccaaaaatgatgcaccagtttgctattttgcagtaagttttggctatgtgactgtttcccttctt----ctagctagctagcgacg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49732480 |
taattatgggatcgccaaaaatgatgcaccagtttgctattttgcagtaagttttggctatgtgactgtttcccttcttctagctagctagctagcgacg |
49732579 |
T |
 |
| Q |
114 |
aaatgaaaggatgtgtcgttgtatagtcttttgcggcgttgtttaatagggtgacctgacacaaacaagcaatgaccctgaaaatcagattaggttcggg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49732580 |
aaatgaaaggatgtgtcgttgtatagtcttttgcggcgttgtttaatagggtgacctgac----acaagcaatgaccctgaaaatcagattaggttcggg |
49732675 |
T |
 |
| Q |
214 |
gatgtgtatttatttgtttcttctcact |
241 |
Q |
| |
|
|| ||||||||||||||||||||||||| |
|
|
| T |
49732676 |
gacgtgtatttatttgtttcttctcact |
49732703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University