View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13378_high_7 (Length: 234)
Name: NF13378_high_7
Description: NF13378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13378_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 114 - 224
Target Start/End: Original strand, 34771828 - 34771938
Alignment:
| Q |
114 |
gagaatctgggatggttggttgttatgagttataattttgttaatcttattttgtttcagcttatgaaagggaaagacatgagatgacctgcttgtgcaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34771828 |
gagaatctgggatggttggttgttatgagttataattttgttaatcttattttgtttcagcttatgaaagggaaagacatgagatgacctgcttgtgcaa |
34771927 |
T |
 |
| Q |
214 |
ttataatgatg |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
34771928 |
ttataatgatg |
34771938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 34771715 - 34771760
Alignment:
| Q |
1 |
tgctacatgttacattacatctttccaaacttgatagacttttacc |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34771715 |
tgctacatgttacattacatctttccaaacttgatagacttttacc |
34771760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University