View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13378_low_11 (Length: 234)

Name: NF13378_low_11
Description: NF13378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13378_low_11
NF13378_low_11
[»] chr6 (2 HSPs)
chr6 (114-224)||(34771828-34771938)
chr6 (1-46)||(34771715-34771760)


Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 114 - 224
Target Start/End: Original strand, 34771828 - 34771938
Alignment:
114 gagaatctgggatggttggttgttatgagttataattttgttaatcttattttgtttcagcttatgaaagggaaagacatgagatgacctgcttgtgcaa 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34771828 gagaatctgggatggttggttgttatgagttataattttgttaatcttattttgtttcagcttatgaaagggaaagacatgagatgacctgcttgtgcaa 34771927  T
214 ttataatgatg 224  Q
    |||||||||||    
34771928 ttataatgatg 34771938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 34771715 - 34771760
Alignment:
1 tgctacatgttacattacatctttccaaacttgatagacttttacc 46  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
34771715 tgctacatgttacattacatctttccaaacttgatagacttttacc 34771760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University