View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13378_low_5 (Length: 326)
Name: NF13378_low_5
Description: NF13378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13378_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 310
Target Start/End: Original strand, 30418412 - 30418707
Alignment:
| Q |
20 |
atcatagagtcactcaccatccaaaccccc-aacctccacacacgccaccttatctggaactttccgactgaggtaccagaaaattcaaaatcagaccgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
30418412 |
atcatagagtcactcaccatccaaaccccccaacctccacacacgccaccttatttggaactttccgactgaggtaccagaaatttcaaaatcaaaccgt |
30418511 |
T |
 |
| Q |
119 |
ttttctagatcctggcactcc----ttccgttgcccttttcaaccacccacgagtcaaaatcgattcgctttaccactagatgccgatgaagagtggtcc |
214 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30418512 |
ttttctagatcctagcactccctccttccgttgcccttttcaaccacccacgagtcaaaattgatccgctttaccactagatgccgatgaagagtggtcc |
30418611 |
T |
 |
| Q |
215 |
tccttaccaaagatgtgatgatattgattctcgccaccatcacactattcccagccaccgtttcttcatcaaaatctgaaaatttcaagttgttct |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
30418612 |
tccttaccaaagatgtgatgatattgattctcgccaccatcacactatttccagccaccgtctcttcatcaaaatctgaaaatgtcaagttgttct |
30418707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University