View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13378_low_7 (Length: 270)
Name: NF13378_low_7
Description: NF13378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13378_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 92 - 258
Target Start/End: Original strand, 46009831 - 46010001
Alignment:
| Q |
92 |
gttggatatgttggtgaatgaaacgttaacagttatggttggcggcacgtgagtgaaaggggggtgggtccgtacgtaaaggacgtcgtcgttttggtga |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46009831 |
gttggatatgttggtgaatgaaacgttaacagttatggttggcggcacgtgagtgaaaggggggtgggtccgtacgtaaaggacgtcgtcgttttggtga |
46009930 |
T |
|
| Q |
192 |
t----gatgatggtgatagtgggatttcaacggggagacatgaaacagaggttgtcacatggggatttagt |
258 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46009931 |
tgatcgatgatggtgatagtgggatttcaacggggagacatgaaacagaggttgtcacatggggatttagt |
46010001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University