View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13378_low_9 (Length: 242)
Name: NF13378_low_9
Description: NF13378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13378_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 25936028 - 25936236
Alignment:
| Q |
18 |
atgaaggcatattggggcaatgatgtatttgctaaggtatattctttattttgtgagctcacatggtttcatagaatccatgtcaatacaccttttgatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25936028 |
atgaaggcatattggggcaatgatgtatttgctaaggtatattctttattttgtgagctcacatggtttcatagaatccatgtcaatacaccttttgatg |
25936127 |
T |
|
| Q |
118 |
ttgagtatctgtttgagtttttaggcatttataacagttgttgactgatatacccttaatatcatatatggcataataacacattcacttcatgtgcatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25936128 |
ttgagtatctgtttgagtttttaggcatttataacagttgttggctgatatacccttaatatcaaatatggcataataacacattcacttcatgtgcatg |
25936227 |
T |
|
| Q |
218 |
cagctttgt |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
25936228 |
cagctttgt |
25936236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University