View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13380_low_7 (Length: 408)
Name: NF13380_low_7
Description: NF13380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13380_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 1e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 11 - 189
Target Start/End: Original strand, 37843330 - 37843508
Alignment:
| Q |
11 |
gatgtgcaggtcatgatctagtactcattcaaattttcaaaagtttgtaaaaccacgctttcaaatatttttataggggataatttatccccgcttcctc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37843330 |
gatgtgcaggtcatgatctagtactcattcaaattttcaaaagtttgtaaaaccacgctttcaaatattttcataggggataatttatccccgcttcctc |
37843429 |
T |
 |
| Q |
111 |
tccctcgtgcttattgatacattcgtcatatcgactagcacatgtaacattttggtgattatattaaaaaacaattaca |
189 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37843430 |
tccctcgtgcttattgctacattcgtcatatcgactagcacatgtaacattttggtgattatattaaaaaacaattaca |
37843508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University