View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13381_low_12 (Length: 504)
Name: NF13381_low_12
Description: NF13381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13381_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 7e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 192 - 290
Target Start/End: Complemental strand, 31008734 - 31008636
Alignment:
| Q |
192 |
aaacttttgaagccaacaacatgcatttaacttccatgaaattaaaaacacataaaatatgaactaacaaaatattgacaaacataaagatacaaccat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31008734 |
aaacttttgaagccaacaacatgcatttaacttccatgaaattaaaaatacataaaatatgaactaataaaatattgacaaacataaagatacaaccat |
31008636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 79 - 120
Target Start/End: Complemental strand, 31008849 - 31008808
Alignment:
| Q |
79 |
ttaaactgtttacatatgaagttgaaagaacttactgccatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31008849 |
ttaaactgtttacatatgaagttgaaagtacttactgccatt |
31008808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University