View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13381_low_25 (Length: 363)
Name: NF13381_low_25
Description: NF13381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13381_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 17 - 348
Target Start/End: Original strand, 4926243 - 4926575
Alignment:
| Q |
17 |
attttgatggcagcata-gcatttgtataactgaaaaaagagattgtaattggctatttacaagaggaggataagaccagatttgattttttgtaatatt |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4926243 |
attttgatggcagcatatgcatttgtataactgaaaaaagagattgttattggctatttacaagaggaggataagaccagatttgattttttgtaatatt |
4926342 |
T |
|
| Q |
116 |
gtaggatattcacgaaatttgagataaagggattattttatcttagatttaaataggcattggttgctaggttgcatcacagtaaatttaaataggattt |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4926343 |
gtaggatattcactaaatttgagataaagggattattttatcttagatttaattaggcattggttgctaggttgcatcacagtaaatttaaataggattt |
4926442 |
T |
|
| Q |
216 |
tatcttagaattaaaaggtaacagaataatgaagatttagtttaactggataattgcgtacttcattactgtttcacttctagcatttatgttggatgct |
315 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4926443 |
tatcttagaattaaaaggtaatagaatattgaagatttagtttaactggataattgcatacttcattactgtttcacttctagcatttatgttggatggt |
4926542 |
T |
|
| Q |
316 |
tttacattattacatgctctttaagcacctatg |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4926543 |
tttacattattacatgctctttaagcacctatg |
4926575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University