View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13381_low_28 (Length: 297)
Name: NF13381_low_28
Description: NF13381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13381_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 17 - 279
Target Start/End: Original strand, 39083980 - 39084242
Alignment:
| Q |
17 |
atgaacaagatatatttgatgcttccagtgaagcaagggaagcctattggtttaagcggtgaagaaactcgccgagttcttttgatggttaattctattc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39083980 |
atgaacaagatatatttgatgcttccagtgaagcaagggaagcctattggtttaagcggcgaagaaactcgccgagttcttttgatggttaattctattc |
39084079 |
T |
|
| Q |
117 |
tgaattctaattatgttttgtgttcttctaagtttcttccttggtttagtagtttatgtcataacagtgaaattgtggagcctcagagaaaggaagaggt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39084080 |
tgaattctaattatgttttgtgttcttctaagtttcttccttggtttagtagtttatgtcataacagtgaaattgtggaacctcagagaaaggaagaggt |
39084179 |
T |
|
| Q |
217 |
gatggaggagaagggagagagacatgatttttcggagaatttgccggaaataatggaagggag |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39084180 |
gatggaggagaagggagagagacatgatttttcggagaatttgccggaaataatggaagggag |
39084242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University