View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13381_low_34 (Length: 218)
Name: NF13381_low_34
Description: NF13381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13381_low_34 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 54715863 - 54715646
Alignment:
| Q |
1 |
actgccacgtgtcacaccaggaaccctttgatcaatgctgctaataataacatcaacggtagttccaaccctatcaccgcatctaacggtgatgggccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54715863 |
actgccacgtgtcacaccaggaaccctttgatcaatgctgctaataataacatcaacggtagttccaaccctatcaccgcatctaacggtgatgggccat |
54715764 |
T |
 |
| Q |
101 |
cttctcccggaatgtccgttaacagcatcgtcaaagatgctaactccgcttctaagtcgtagacgccgtttgtttcgttgactttttcactcaacagaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54715763 |
cttctcccggaatgtccgttaacagcatcgtcaaagatgctaactccgcttctaagtcgtagacgccgtctgtttcgttgactttttcactcaacagaga |
54715664 |
T |
 |
| Q |
201 |
cataaacaaaagagtagc |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
54715663 |
cataaacaaaagagtagc |
54715646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University