View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13382_high_18 (Length: 424)
Name: NF13382_high_18
Description: NF13382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13382_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 61 - 409
Target Start/End: Complemental strand, 3909247 - 3908899
Alignment:
| Q |
61 |
ttaattgaagtggtgctgatagtactccataaagattgatcagaggctctgttgttaccactattgatgaagttttgaggccaattttcattataagcag |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3909247 |
ttaattgaagtggtgctgatagtactccataaagattgatcagaggctctgttgttaccactattgatgaagctttgaggccaattttcattataagcag |
3909148 |
T |
|
| Q |
161 |
tagaaacagtagcaacagaagtagtagcattaaccatgctagatggaggaatcaaattcaaacctcgtggttgagaggtaaacattggtcctgatccatt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3909147 |
tagaaacagtagcaacagaagtagtagcattaaccatggtagatggaggaatcaaattcaaacctcgtggttgagaggtaaacattggtcctgatccatt |
3909048 |
T |
|
| Q |
261 |
accacctagttgaaagaattgttgcggaggtggacgattttgtccttgtgatgagcttacaagagcagcagcagcaacattgaaaccttgtaaaaggctc |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3909047 |
accacctagttgaaagaattgttgcggaggtggacgattttgtccttgtgatgagcttacaagagcagcagcagcaacattgaaaccttgtaaaaggctc |
3908948 |
T |
|
| Q |
361 |
aaatttgaagaagaaccaagaccaagaccaactccaacaccaagattct |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3908947 |
aaatttgaagaagaaccaagaccaagaccaactccaacaccaagattct |
3908899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University