View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13382_high_33 (Length: 309)
Name: NF13382_high_33
Description: NF13382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13382_high_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 29 - 306
Target Start/End: Original strand, 8880783 - 8881060
Alignment:
| Q |
29 |
cacaaaaccaacttttaaggttgaaattgtctccacttataaacacatattcctatcaattgttcgacgtggaactctttaacaacatgcatcattaatg |
128 |
Q |
| |
|
||||||| | || |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8880783 |
cacaaaatcgacctttaagattgaaattgtctccacttataaacacatattcctatcaattgttcgacgtggaattctttaacaacatgcatcattaata |
8880882 |
T |
|
| Q |
129 |
ttattataaagctatagtaaatatgaatatttgttattatgaaatggaattgtagaaaatcgaggacactctgtaaaccttcttaactttgaaaacaaca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8880883 |
ttattataaagctatagtaaatatgaatatttgttattatgaaatggaattgtagaaaatcgaggacactctgtaaaccttcttaactttgaaaacaaca |
8880982 |
T |
|
| Q |
229 |
ggtgaatgaggcaaagctaatcactcccatgcacacgtccctttctctctacgttcccccacctctgccgcctatgct |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8880983 |
ggtgaatgaggcaaagctaatcactcccatgcacacgtccctttctctctacgttcccccacctctgccgcctctgct |
8881060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 217 - 301
Target Start/End: Complemental strand, 42028306 - 42028224
Alignment:
| Q |
217 |
ttgaaaacaacaggtgaatgaggcaaagctaatcactcccatgcacacgtccctttctctctacgttcccccacctctgccgcct |
301 |
Q |
| |
|
||||||||||||||||| || | ||||||| |||| ||||||||||||||||||||| || | |||||||| |||||||||| |
|
|
| T |
42028306 |
ttgaaaacaacaggtgagtgtgtgaaagcta-tcac-cccatgcacacgtccctttctagctcctctcccccacatctgccgcct |
42028224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University