View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13382_high_35 (Length: 300)
Name: NF13382_high_35
Description: NF13382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13382_high_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 131 - 288
Target Start/End: Complemental strand, 38225119 - 38224965
Alignment:
| Q |
131 |
gaactagacatagatcctcaaatcctgcgggtgcctaaaatttgttttagaaaacatttaatagttagagatataaaattggaccctctcattataattt |
230 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38225119 |
gaactagacatagatcctcaaatcctgtgggtgcctaaaatttgtt---gaaaacatttaatagttagagatataaaattggaccctctcattataattt |
38225023 |
T |
|
| Q |
231 |
gatatatccaagttgcaaattttgaaaactgtctttaaattgtatcagaaaatatatt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38225022 |
gatatatccaagttgcaaattttgaaaactgtctttaaattgtatcagaaaatatatt |
38224965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 38225249 - 38225186
Alignment:
| Q |
1 |
aaagagcacttttttatttgaacaatttctgaagggccaatttttgctcgagggggagtagtag |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38225249 |
aaagagcacttttttatttgaacaatttctgcagggccaatttttgctcgagggggagtagtag |
38225186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University