View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13382_high_37 (Length: 295)
Name: NF13382_high_37
Description: NF13382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13382_high_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 15593634 - 15593484
Alignment:
| Q |
1 |
ttgaaaaaatagaataattgaacgtagtcacatgtgtttgtgtcgtgtcagtgctacataggtcttgattaatcaactttcctatcaatgcggcagacta |
100 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||| |
|
|
| T |
15593634 |
ttgaaaaaatagattaatcgaacatagtcacatgcgtttgtgtcgtgtcagtgctacataggtcttgattcatcaactttcctatcaatgtgggagacta |
15593535 |
T |
|
| Q |
101 |
taagtttccaattcaagcaactacaaagcctgtaaatcccaatatactagca |
152 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
15593534 |
taag-ttccaattcaagtaactacaaagcctgtaaattccaacttactagca |
15593484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 160 - 216
Target Start/End: Complemental strand, 15593380 - 15593324
Alignment:
| Q |
160 |
gagcaagaatgaagtgttgtcacttgccatcactcatcctggtttcctctattaggg |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| | ||||||||||||| |||| |
|
|
| T |
15593380 |
gagcaagaatgaagtgttgtcacttgcaatcactcaccgtggtttcctctatcaggg |
15593324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 237 - 280
Target Start/End: Complemental strand, 15593299 - 15593256
Alignment:
| Q |
237 |
gaacaagccaccacaccatcctcatcagttccattccacttcat |
280 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
15593299 |
gaacaagccaccacaccatcctcgttagttccattccacttcat |
15593256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University