View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13382_high_42 (Length: 251)
Name: NF13382_high_42
Description: NF13382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13382_high_42 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 911214 - 910994
Alignment:
| Q |
14 |
aagcaaaggtggattcaagaagatgctacaaagtagtcccggatagttctctttagggagggcggtggattcaatacagacgaagggctcttcaaagcag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
911214 |
aagcaaaggtggattcaagaagatgctacaaagtagtcccggatagttctctttagggagggcggtggattcaatacagacgaagggctcttcaaagcag |
911115 |
T |
|
| Q |
114 |
actctggagtgtttttaggagatatggttagatcaaattctgatgaaagctggttcttgtggccttcagatgtagttgttttaggtggtgtaattggagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
911114 |
actctggagtgtttttaggagatatggttagatcaaattctgatgaaagctggttcttgtggccttcagatgtagttgttttaggtggtgtaattggagt |
911015 |
T |
|
| Q |
214 |
ggctgactttactgggtcctg |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
911014 |
ggctgactttactgggtcctg |
910994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 24 - 231
Target Start/End: Original strand, 660744 - 660951
Alignment:
| Q |
24 |
ggattcaagaagatgctacaaagtagtcccggatagttctctttagggagggcggtggattcaatacagacgaagggctcttcaaagcagactctggagt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
660744 |
ggattcaagaagatgctacaaagtagtcccggatagttctctttagggagggcggtggattcaatacagacgaagggctcttcaaagcagactctggagt |
660843 |
T |
|
| Q |
124 |
gtttttaggagatatggttagatcaaattctgatgaaagctggttcttgtggccttcagatgtagttgttttaggtggtgtaattggagtggctgacttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
660844 |
gtttttaggagatatggttagatcaaattctgataaaagctggttcttgtgcccttcagatgtagttgttttaggtggtgtgattggagtggctgacttt |
660943 |
T |
|
| Q |
224 |
actgggtc |
231 |
Q |
| |
|
|||||||| |
|
|
| T |
660944 |
actgggtc |
660951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 25 - 75
Target Start/End: Original strand, 658283 - 658333
Alignment:
| Q |
25 |
gattcaagaagatgctacaaagtagtcccggatagttctctttagggaggg |
75 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| | ||||||||| |
|
|
| T |
658283 |
gattcaagaagatgctacaaagtagtctcggatagttctttatagggaggg |
658333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University