View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13382_high_48 (Length: 222)

Name: NF13382_high_48
Description: NF13382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13382_high_48
NF13382_high_48
[»] chr2 (1 HSPs)
chr2 (18-201)||(44407024-44407207)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 44407024 - 44407207
Alignment:
18 aatactaacatgtatgtattcagggcaaagccatctcttgctggaaaatttaggataggatagttccagtggcattgatgttattttttgctgaatttag 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44407024 aatactaacatgtatgtattcagggcaaagccatctcttgctggaaaatttaggataggatagttccagtggcattgatgttattttttgctgaatttag 44407123  T
118 tggcattttcattttatgattcaaataaaaccctgtgctctctccctaggatctctcaaatccaactcactcatatctctctct 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44407124 tggcattttcattttatgattcaaataaaaccctgtgctctctccctaggatctctcaaatccaactcactcatatctctctct 44407207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University